Authors: Shakila Umer, Khushi Muhammad, Sajjad Sajjad, Latifa AlHusnain, Muneera D. F. AlKahtani, Abdul Majid, Hamid Ali, Irfan Ullah, Aqib Zeb, Sajad Ali, Azizullah Khalili, Seung Hwan Yang, Sajid Fiaz, Kotb A. Attia
Categories: Article, DNA barcoding, Biodiversity hotspot, Western Himalayan Pakistan, Endemism, Molecular markers, Phylogeny, Ecology, Plant sciences, Zoology
Source: Scientific Reports
Authors: Shakila Umer, Khushi Muhammad, Sajjad Sajjad, Latifa AlHusnain, Muneera D. F. AlKahtani, Abdul Majid, Hamid Ali, Irfan Ullah, Aqib Zeb, Sajad Ali, Azizullah Khalili, Seung Hwan Yang, Sajid Fiaz, Kotb A. Attia
The Himalayan region is recognized as one of the world’s major biodiversity hotspots due to its remarkable altitudinal variation, high species richness, and exceptional endemism. Despite its ecological significance, the endemic flora of the western Himalayas remains insufficiently explored at the molecular level. This study aimed to evaluate the performance of multiple nuclear and chloroplast DNA barcode loci (ITS2, rbcL, trnH-psbA, trnA, trnV, rpoB, ycf3, and rbcLa) for the identification and phylogenetic assessment of 32 endemic and threatened plant species representing 31 genera and 24 families from the western Himalayan region of Pakistan, such as Thalictrum secundum Edgew. Aquilegia pubiflora Wall. ex Royle, Anemone obtusiloba D.Don and Delphinium cashmerianum Royle of family (Ranunculaceae), Pimpinella stewartii (C.B. Clarke) Nasir (Umbeliferaceae), Bistorta amplexicaulis (D.Don) Greene, and Bistorta affinis (D.Don) Greene (Polygonaceae) Abelia triflora R.Br. ex Wall. And Lonicera japonica Thunb. (Caprifoliaceae), Aesculus indica (Wall. ex Cambess.) Hook. (Sapindaceae), Arisaema utile Nakai (Araceae), Coriaria nepalensis Wall. (Coriaraceae), Desmodium elegans DC (Papilionacea), Daphne papyracea Wall. ex Steud. (Thymelaceae), Epimedium elatum C.Morren. (Berberidaceae), Galium tetraphyllum. Nazim. & Ehrend. (Rubiaceae), Bupleurum lanceolatum Wall. ex August. and Heracleum polyadenum Franchet (Apiaceae), Impatiens edgeworthii Hook.f. (Balsaminaceae), Incarvillea emodi Chatterjee (Bignoniaceae), Potentilla erecta (L.) Raeusch., Cotoneaster frigidus var. affinis (Lindl.) Wenz., and Spiraea hazarica R.Parker (Rosaceae), Phytolacca latbenia (Moq.) H.Walter. (Phytolaccaceae), Rhamnus parvifolius Bunge. (Rhamnaceae), Thymus linearis Benth. (Lamiaceae), Jasminum leptophyllum Wall. ex G.Don (Oleaceae), Rhododendron lepidotum Wall. ex Hook.f. (Ericaceae), Swertia ciliata Roxb. ex Fleming. (Gentianaceae), Zanthoxylum armatum DC. (Rutaceae), Dioscorea balcanica Kosanin (Dioscoreaceae), and Deutzia staminea R.Br. ex Wall. (Hydrangeaceae). Among the tested markers, rbcL showed the highest PCR amplification (100%) and sequencing success (96%), followed by trnH-psbA (100% amplification, 80% sequencing success), whereas ITS2 exhibited comparatively lower sequencing efficiency (52%). BLAST analysis demonstrated ≥ 97% sequence identity for most taxa, and best Match/Best Close Match analysis indicated higher discrimination efficiency for rbcL and trnH-psbA compared with other loci. Multilocus phylogenetic analysis further confirmed taxonomic placement at the family, genus, and species levels. Overall, this study demonstrates that a multilocus DNA barcoding approach provides reliable species authentication and phylogenetic resolution for endemic Himalayan flora, contributing valuable molecular reference data to global databases and supporting conservation and taxonomic efforts in this biodiversity-rich yet understudied region.
The Himalayan “Him and Alaya” means “abodes of snow” mountain system, extending over approximately 2400 km across South and Central Asia. It constitutes one of the most significant global biodiversity hotspots^1^. Its vast altitudinal gradient, ranging from subtropical foothills to nival zones above 7000 m, generates an extraordinary diversity of ecological niches and microhabitats^2^. The western Himalayan region, encompassing northern Pakistan, northwestern India, and parts of western Nepal, is distinguished by its complex orogeny, varied edaphic conditions, and pronounced climatic heterogeneity^3^. These factors have facilitated high levels of speciation and endemism, rendering the region a repository of unique genetic resources and an invaluable center of plant diversity^4^.
Floral diversity in the western Himalaya area is the basis of ecosystem stability and is the source of abundant ecosystem services^5^. A large number of species are used as a source of medicine, fragrance, decoration, and food supplements, which are the main ingredients of traditional ethnobotanical knowledge and are the source of rural livelihoods^6,7^. In fact, endemic taxa are mainly examples of unique evolutionary lineages which are irreplaceable^8^. Often, they have acquired specialized adaptations for very narrow ecological niches^9^. They have very limited distribution ranges and are thus very susceptible to environmental changes, including human-induced habitat degradation, overharvesting, invasion by alien species, and climate change-driven shrinking of their ranges^10^. Their extinction would not only erode global biodiversity but also diminish future opportunities for biotechnological, pharmaceutical, and ecological applications^11^.
Despite the vast botanical importance of the region, there still exists a major taxonomic and molecular knowledge gap. Historically, conventional plant identification in the western Himalaya has been based on morphological taxonomy that, although being the basis, has limitations such as phenotypic plasticity, developmental variation, seasonal morphology, and the presence of cryptic or closely allied species^12,13^. In addition, herbarium collections and floristic inventories for most of the endemic taxa are incomplete or have not been updated, whereas molecular reference sequences for these species are lacking or not at all available in public databases^14^. As a result, a great number of plant species in the area were misidentified, undocumented, or totally unrecognized in global biodiversity assessments, thereby hindering the conservation prioritization process^15^.
In this context, DNA barcoding is noted as a giant leap for plant systematics and biodiversity research^16^. This molecular diagnostic tool takes the use of short, standardized genetic loci typically chloroplast regions such as matK and rbcL, and nuclear regions such as ITS1 and ITS2 to produce repeatable sequence signatures for species-level identification^17^. DNA barcoding has several advantages over traditional approaches, such as morphological, physiological, and anatomical. It can provide the correct identification of a sample even if it is a minute or fragmentary material, it can distinguish morphologically similar or cryptic taxa and it also allows integration of regional biodiversity data into global repositories such as the Barcode of Life Data System (BOLD), and GenBank^18–20^. Moreover, when combined with phylogenetic analysis, DNA barcoding can elucidate evolutionary relationships, assess genetic distinctiveness, and detect novel previously unreported taxa^21^.
Given the limited molecular characterization of endemic flora from the western Himalayan region, there is a critical need to integrate DNA based approaches for accurate species identification and phylogenetic assessment. Therefore, the main objective of this study was to authenticate selected endemic and rare plant species from the western Himalayas using a multi-locus DNA barcoding strategy and to evaluate their phylogenetic relationships. This study generated and analyzed sequence data from chloroplast and nuclear barcode markers to confirm taxonomic identity, assess genetic relatedness among species, and provide reliable molecular reference records for regionally important endemic taxa. The outcome of this research aims to strengthen molecular taxonomic knowledge of western Himalayan flora and support biodiversity conservation and future genetic resource management in this ecologically sensitive region.
The current study was carried out in the Himalayan region of Pakistan. The Western Himalayan region in Pakistan, part of the broader Himalayan system, is a key biodiversity hotspot that extends across the northern areas and Azad Jammu and Kashmir, covering approximately 50,916 km^2^^22^. It stretches approximately 320 km into Pakistan and is bordered by Himachal Pradesh in India. This region includes three major Ladakh, Pir Panjal, and Zaskar^23^. The area is known for its diverse habitats, primarily broadleaf and coniferous forests, which support a wide range of plant biodiversity, including many medicinal species^24^. Protected areas such as Ayubia National Park, Gol National Park, Chitral, and Machiara National Park preserve these ecosystems^25^. Despite its ecological importance, the region remains underexplored due to its remoteness, harsh terrain, and challenging climate. As a result, plant species distribution and diversity are poorly documented^26^. Comprehensive research is needed to fill these gaps and support conservation efforts. The current study was conducted to explore and document the rich but understudied flora of this significant region (Fig. 1).
Fig. 1Map of study areas projecting the Western region of the Himalayas. Sampling sites were plotted in QGIS v3.32.2 using the MODIS Terra Vegetation Indices (MOD13A1 v6.1) dataset^27^ as the vegetation layer. Red circles indicate specimen collection sites. (Qgis Association. QGIS geographic information system, //www.qgis.org).
Multiple field visits were conducted across various sites in the Western Himalayan region to document and collect endemic plant species (Fig. 1). All plant material used in this study was collected under a permit issued by the Wildlife Department. Collection, handling, and experimental procedures complied with relevant institutional, national, and international guidelines and legislation for research involving plants. Species were identified based on literature and the Flora of Pakistan, focusing on those with restricted distributions and specific habitat requirements, and their reported locations were verified before fieldwork. During field visits, herbaceous plants were carefully uprooted, while branches with leaves were collected from trees, ensuring the collection of flowers, fruits, leaves, and, when necessary, roots for accurate morphological identification. Collected plant tissues were preserved in plastic bags to maintain specimen quality during transport. The plant samples were collected from the Himalayan region of Pakistan and deposited in the Herbarium of Hazara University for future reference. The voucher identification numbers listed in Table 1 were obtained with the permission of the relevant institutional ethical research cmmittee. Although species identifications are available in online floras with corresponding references, all specimens included in the present study were formally identified and authenticated by Dr. Abdul Majid, Department of Botany, Hazara University, Mansehra, who also provided the voucher specimens (Table 1).
Table 1A descriptive table showing the collection site, GPS coordinates, and family details.Herbarium voucher IDFamilySpeciesGPS pointDate of collectionReferences6257Apiaceae Heracleum polyadenum FranchetN 34.20E 73.521210 m14/08/2017^27^6278 Bupleurum lanceolatum Wall. ex August.N 34.05E 73.473044 m21/08/2017^28^6312Araceae Arisaema utile NakaiN 34.05E 73.4162500 m23/09/2017^29^6298Balsaminaceae Impatiens edgeworthii Hook.f.N 33.998E 73.5911979 m23/09/2017^29^6299Berberidaceae Epimedium elatum C. MorrenN 34.05E 73.411613 m23/09/2017^30^4626Bignoniaceae Incarvillea emodi ChatterjeeN 33.99E 73.591615 m08/08/2017^29^6240Caprifoliaceae Lonicera japonica Thunb.N 34.340E 73.7381945 m07/12/2018^31^6243 Abelia triflora R. Br. ex Wall.N 34.90E 73.61356 m23/07/2012^32^6283Coriaraceae Coriaria nepalensis WallN 34.239E 73.201486 m21/08/2017^33^6244Papilionacea Desmodium elegans DC.N 34.605E 73.2102350 m23/09/2017^34^6272Rubiaceae Galium tetraphyllum. Nazim. & Ehrend.N 34.045E 73.3922235 m20/08/2017^35^6313Spindaceae Aesculus indica (Wall.ex Camb.) Hook. f.N 34.045E 73.4862235 m23/09/201s7^36^6303LabiateaeThymus linearis BenthN 33.88E 73.363338 m23/09/2017^37^6309Oleaceae Jasminum leptophylum Wall. ex G.DonN 35.60E 73.092345 m12/10/2012^38^6374Gentianaceae Swertia ciliata Roxb. ex FlemingN 34.170E 73.6402336 m12/10/2012^38^6310HydrangeaceaeDeutzia staminea R. Br. ex. Wall.N 34.100E 73.352350 m23/09/2017^32^6266Polygonaceae Bistorta amplexicaulis (D. Don) GreeneN 34.078E 73.7402236 m19/08/2017^38^6269 Bistorta affinis (D. Don) GreeneN 33.588E 73.461675 m21/08/2017^39^6291Ranunculaceae Thalictrum secundum EdgewN 34.045E 73.3922235 m21/8/127^38^6230 Anemone obtusiloba D.DonN 33.870E 73.7131603 m8/17/2018^38^6233 Delphinium cashmerianum RoyleN 34.639E 73.4682067 m16/10/2017^37^4627 Aquilegia pubiflora Wall. ex RoyleN 34.25E 73.322031 m17/08/2017^37^6371Umbeliferaceae Pimpinella stewartii (C.B. Clarke) NasirN 34.29E 73.342041 m19/10/2017^37^6264Rhamnaceae Rhamnus parvifolius BungeN 34.20E 73.021231 m17/08/2017^38^6267Rosaceae Spiraea hazarica R.N.parkerN 34.18E 73.3823/10/2012^38^6270 Potentilla erecta (L.) RaeuschN 34.62E 73.5323/10/2012^40^6268 Cotoneaster frigidus var. affinis (Lindl.) WenzN 34.55E 73.501820 m19/08/2017^41^6255Rutaceae Zanthoxylum armatum DC.N 34.20E 73.521210 m12/08/2017^42^6259Thymelaceae Daphne papyracea Wall. ex Steud.N 34.830E 73.3104170 m14/08/2017^43^6292Dioscoreaceae Dioscorea balcanica KosaninN 34.120E 73.391371 m23/09/2017^29^6239Ericaceae Rhododendron lepidotum Wall. ex Hook.f.N 34.340E 73.7381945 m10/09/2017^31^4628Phytolaccaceae Phytolacca latbenia (Moq.) H.Walter.N 34.25E 73.451315 m21/09/2016^41^
The CTAB (Cetyl trimethyl ammonium bromide) method was used to extract total genomic DNA with some modifications^44^. A fine powder of the weighed samples was made by grinding in a mortar and pestle. For each 100 mg of ground tissue, 800 µL of pre-warmed CTAB Extraction Buffer was used at 65 °C. The mixture was vortexed thoroughly. The homogenate was then incubated for 2 h at 65 °C. After incubation, 600 µl of PCI was added, and the homogenate was centrifuged for about 20 min at 13,000 rpm. The supernatant, along with 500 µL of ice cold iso-propanol, was frozen overnight^45^. The samples were again centrifuged for 20 min at 13,000 rpm, and then isopropanol was added. 500 µL of 70% ethanol was added, and the samples were centrifuged for 10 min at 13,000 rpm. The tubes were inverted for drying to remove ethanol completely^46^. To dilute the dried sample, 60–80 µL of ddH2O was added. The concentration and quality of extracted DNA were checked on 1% agarose gel electrophoresis. Added 1 gram of agarose powder in combination with 2 ml TAE in 98 ml dH2O. Preheated the solution in a microwave oven till solution became transparent. 20 uL ethidium bromide was added to the mixture, shaken well, poured into the gel tray, and combs were fitted for well production. The gel was transferred into the gel tank, and the DNA sample of 2 uL was loaded with the addition of 2ul loading dye, connected the power supply, and ran the sample for 20 min. The gel product was confirmed by UV Trans-illuminator^47^.
The most-studied and well-known primers for the nuclear and chloroplast genomes of plants were selected, as shown in Table 2. The selected primers were amplified according to the prescribed conditions. The volume of 25 µL of PCR reaction mixture was prepared in a 200 µL PCR tube, and each tube contained approximately 14 µl ddH2O, 2 µl of DNA template, 2.5 µl of 10× PCR buffer, 2 µl MgCl2, 2 µl of dNTPs 0.5 units of Taq Polymerase kit (Catalog no. K0171), and 2 µl of each forward primer and reverse primer. Amplification was performed on an Applied Biosystems 2720 Thermal Cycler. The initial step for 5 min at 94 °C was followed by 35 cycles of 30 s at 94 °C, 40 s at 52 °C, 35 s at 72 °C, and 1 cycle at 72 °C for 10 min. The amplified products were electrophoresed on 1% TAE agarose gel.
Table 2Detailed description of selected DNA barcoding marker, along with forward and reverse primer sequences and PCR conditions.Name of barcodesSequences (5ʹ to 3ʹ)ReferencesPCR conditionsITS2 FITS2 R5′GGAAGTAAAAGTCGTAACAAGG3′5′TCCTCCGCTTATTGATATGC3′^48,49^37 cycles, 95°c 20s, 55°c 01 min, 72°c 2 min,, 72°c 10 min, Hold 4°c RbcL IF RbcL 13515′ATGTCACCACAAACAGAGACTAAAG3′5′GCAGCAGCTAGTTCCGGGCTCCA3′^50,51^35 cycles, 94°c 45s, 53°c 30s, 72º 01 min,, 72°c 10 min, Hold 4°c trnH-psbA F
trnH-psbA R 5′GTTATGCATGAATGCTC3′5′CGCGCATGGTGGATTCACAATCC3′^52,53^35 cycles, 94°c 45s, 53°c 30s, 72º 01 min,, 72°c 10 min, Hold 4°c matK-F matK -R5′ATTTYTGGARGAYAGAYTDCC3′5′CGTRGTATATATCTCRATYTACGC3′^50,54^30 cycles, 94°c 30s, 50°c 30s 72°c 1.5 min,, 72°c 10 min, Hold 4°c rbcLa-F rbcLa-R5′ATGTCCACAAACAGAGACTAAAGC3′5′GTAAAATCAAGTCCACCCACG3′^55,56^40 cycles, 94°c 4 min, 94°c 30s, 55°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c *rpoB-*F rpoB-R5′ATGCAACGTCAAGCAGTTCC3′5′GATCCCAGCATCACAATTCC3′^57^40 cycles, 94°c 5 min, 94°c 30s, 51°c 30s,, 72°c 10 min, Hold 4°c trnA-F trnA-R5′GGTTCAAGTCCCTCTATCCC3′5′ATTTGAACTGGTGACACGAG3′^58,59^40 cycles, 94°c 4 min, 94°c 30s, 52°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c *trnV-*F trnV-R5′GTAGAGCACCTCGTTTACAC3′5′CTCGAACCGTAGACCTTCTC3′^60,61^40 cycles, 94°c 5 min, 94°c 30s, 54°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c. Ycf3-F Ycf3-R5′AGAACCGTACTTGAGAGTTTCC3′5′CTGTCATTACGTGCGRCTATCT3′^62,63^40 cycles, 94°c 5 min, 94°c 30s, 54°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c *matK-*F matK-R5′CCCTATTCTATTCAYCCNGA3′5′CGTATCGTGCTTTTRTGYTT3′^64^40 cycles, 94°c 5 min, 94°c 30s, 50°c 30s, 72°c 30s, 72°c 10 min, Hold 4°c
The PCR-amplified products were sequenced using the Sanger method at Macrogn Inc., South Korea. And after successful sequencing, to ensure the resulting sequences accuracy and to recover numerous defined sequences, the BLAST analysis in GenBank was performed to retrieve the most similar sequences based on Max score, total aligned sequence length, query cover, E. Value, and species identity success (https://blast.ncbi.nlm.nih.gov/Blast.cgi)^65^. Sequences of composed data were arranged via Bio Edit (https://bioedit.software.informer.com/7.2/) and multiple sequence alignment (MUSCLE) software (https://www.ebi.ac.uk/jdispatcher/msa/muscle) aligned by ClustalW (https://www.genome.jp/tools-bin/clustalw)^66–68^. The resultant data was processed to compute the Kimura-2-parameter (K2P) distances for each region by MEGA software (https://www.megasoftware.net)^69^.
Initially, 9 different primers targeting the nuclear and chloroplast genomes were used to amplify and sequence 32 species from 21 families to assess amplification, sequencing, and species identification success rates. Among them, the rbcL region showed 100% PCR amplification and 96% sequencing success rates. The matK region showed a 92% amplification rate, with a lower sequencing success rate of 56.5%. The trnH-psbA primer demonstrated 100% amplification and 80% sequencing success, whereas the ITS region showed lower 80.8% amplification and 52.4% sequencing success. Additionally, five barcode regions (trnV,* trnA*,* rbcLa*,* rpoB*, and ycf3) were tested on six endemic species. For rbcLa, amplification success was 100% with 66.6% sequencing success. The ycf3 region showed 66.6% amplification and 75% sequencing rates, while rpoB achieved 83.3% amplification and 60% sequencing success. The trnA and trnV regions showed 83.3% amplification success, with sequencing rates of 66.6% and 83%, respectively. Overall, the highest sequence recovery was observed for rbcL, followed by trnH-psbA and matK, while ITS had the lowest amplification and sequencing success among the tested regions (Table 3).
Table 3The amplification and sequencing success rate of the candidate’s barcoding region in the desired species.DNA barcode regionrbcLmatKtrnH_psbAITStrnAtrnVrpoBYcf3rbcLaTotal number of species, and amplification success rate in %26/26 (100)24/26 (92)26/26 (100)21/26 (81)06/06 (100)05/06 (83)05/06 (83)04/06 (67)06/06 (100)Number of species, and sequences success rate in %25/26 (96)13/23 (57)21/26 (80)10/20 (52)04/06 (67)04/06 (67)03/05 (60)03/04 (75)04/05 (66.6)
Sequencing success at the family level showed a 100% success rate in Oleaceae, Rhamnaceae, and Balsaminaceae, while several families exhibited moderate to low success rates (Table 3). Among the tested markers, rbcL demonstrated the highest sequencing success rate, with 21 families (91%) successfully sequenced, followed by trnH-psbA, with 13 families. The matK marker showed a 50% success rate in 12 families, while ITS2 had the lowest efficiency, with a 26% success rate across six families. Additionally, trnA,* trnV*, and rbcLa showed an 80% success rate at the identification level, whereas ITS2 consistently exhibited the lowest performance among the tested barcode regions (Table 4). The obtained nucleotide sequences were further submitted to the online GenBank NCBI database https://www.ncbi.nlm.nih.gov/genbank/ (Table 5).
Table 4The descriptive table showing the sequencing success rate of the barcode regions at the family level.FamiliesBarcode regionsOverall family success rate %rbcLmatKtrnH-ITStrnAtrnVYcf3rpoBrbcLaRanunculaceae√=√√=√==√55Umbeliferaceae√===*****25Polygonaceae√√√=√====45Caprifoliaceae√===√√==√45Araceae√√==*****50Coriaraceae√===*****25Papilionacea√===*****25Thymelaceae√=√=*****50Berberidaceae√=√√*****75Rubiaceae=√==*****25Labiateae√√√=*****75Apiaceae√√==*****50Balsaminaceae√√√√*****100Bignoniaceae√===*****25Rosaceae=√√=√√√√√78Phytolaccaceae√√=√*****75Rhamnaceae√√√√*****100Gentianaceae√=√=*50Oleaceae√√√√√100Ericaceae√√√=*****75Gentianaceae√√√=*****75Rutaceae√=√√*****75Dioscoreaceae=√==*****25Hydrangeaceae√√==*****50Note: * not used barcode, √ showed success, = showed no results.
Table 5Detailed description of the obtained DNA barcode sequences submitted to the online GenBank NCBI database.SpeciesBarcode regionGenBank NCBI accession IDs of submitted sequencesAesculus indica (Wall. ex Cambess.) Hook. rbcL LC516689 https://www.ncbi.nlm.nih.gov/nuccore/LC516689
trnH-psbA LC516690 https://www.ncbi.nlm.nih.gov/nuccore/LC516690 Anemone obtusiloba D.DonITS2LC511740 https://www.ncbi.nlm.nih.gov/nuccore/LC511740
rbcL LC511741 https://www.ncbi.nlm.nih.gov/nuccore/LC5117401
trnH-psbA LC511742 https://www.ncbi.nlm.nih.gov/nuccore/LC511742 Arisaema utile Nakai rbcL LC521896 https://www.ncbi.nlm.nih.gov/nuccore/LC521896 Bistorta amplexicaulis (D.Don) Greene matK LC521897 https://www.ncbi.nlm.nih.gov/nuccore/LC521897
trnH-psbA LC521898 https://www.ncbi.nlm.nih.gov/nuccore/LC521898
rbcL LC521899 https://www.ncbi.nlm.nih.gov/nuccore/LC51899 Bupleurum lanceolatum Wall. ex August matK LC521900 https://www.ncbi.nlm.nih.gov/nuccore/LC521900
rbcL LC521901 https://www.ncbi.nlm.nih.gov/nuccore/LC5219001 Coriaria nepalensis Wall. rbcL LC521902 https://www.ncbi.nlm.nih.gov/nuccore/LC521902 Delphinium cashmerianum Royle rbcL LC527402 https://www.ncbi.nlm.nih.gov/nuccore/LC527402
trnH-psbA LC527403 https://www.ncbi.nlm.nih.gov/nuccore/LC527403Daphne papyracea Wall. ex Steud. rbcL LC527404 https://www.ncbi.nlm.nih.gov/nuccore/LC527404 ITS2LC527405 https://www.ncbi.nlm.nih.gov/nuccore/LC527405 Epimedium elatum C.Morren.ITS2LC510370 https://www.ncbi.nlm.nih.gov/nuccore/LC510370
rbcL LC511738 https://www.ncbi.nlm.nih.gov/nuccore/LC511738
trnH-psbA LC511739 https://www.ncbi.nlm.nih.gov/nuccore/LC511739 Desmodium elegans DC rbcL LC527406 https://www.ncbi.nlm.nih.gov/nuccore/LC527406 Deutzia staminea R.Br. ex Wall. matK LC527407 https://www.ncbi.nlm.nih.gov/nuccore/LC527407
rbcL LC527408 https://www.ncbi.nlm.nih.gov/nuccore/LC527408 Dioscorea balcanica Kosanin matK LC527409 https://www.ncbi.nlm.nih.gov/nuccore/LC527409 Galium tetraphyllum Nazim. & Ehrend matK LC527447 https://www.ncbi.nlm.nih.gov/nuccore/LC527447 Heracleum polyadenum Franchet rbcL LC527448 https://www.ncbi.nlm.nih.gov/nuccore/LC527448 Impatiens edgeworthii Hook.f.ITS2LC527449 https://www.ncbi.nlm.nih.gov/nuccore/LC527449
rbcL LC527450 https://www.ncbi.nlm.nih.gov/nuccore/LC527450
matK LC527451 https://www.ncbi.nlm.nih.gov/nuccore/LC527451 Incarvillea emodi Chatterjee rbcL LC527452 https://www.ncbi.nlm.nih.gov/nuccore/LC527452 Lonicera japonica Thunb. rbcL LC527453 https://www.ncbi.nlm.nih.gov/nuccore/LC527453 Phytolacca latbenia (Moq.) H.Walter. matK LC527454 https://www.ncbi.nlm.nih.gov/nuccore/LC527454
rbcL LC527455 https://www.ncbi.nlm.nih.gov/nuccore/LC527455 ITS2LC527456 https://www.ncbi.nlm.nih.gov/nuccore/LC527456 Rhamnus parvifolius Bunge. trnH-psbA LC528220 https://www.ncbi.nlm.nih.gov/nuccore/LC528220 ITS2LC528221 https://www.ncbi.nlm.nih.gov/nuccore/LC528221
matK LC528222 https://www.ncbi.nlm.nih.gov/nuccore/LC528222
rbcL LC528223 https://www.ncbi.nlm.nih.gov/nuccore/LC528223 Rhododendron lepidotum Wall. ex Hook.f. trnH-psbA LC528224 https://www.ncbi.nlm.nih.gov/nuccore/LC528224
matK LC528225 https://www.ncbi.nlm.nih.gov/nuccore/LC528225
rbcL LC528386 https://www.ncbi.nlm.nih.gov/nuccore/LC528386 Swertia ciliata Roxb. ex Fleming. trnH-psbA LC528387 https://www.ncbi.nlm.nih.gov/nuccore/LC528387 Thalictrum secundum Edgew. rbcL LC528388 https://www.ncbi.nlm.nih.gov/nuccore/LC528388 Thymus linearis Benth. trnH-psbA LC528389 https://www.ncbi.nlm.nih.gov/nuccore/LC528389
rbcL LC528390 https://www.ncbi.nlm.nih.gov/nuccore/LC528390 Potentilla erecta (L) Raeusch matK LC528137 https://www.ncbi.nlm.nih.gov/nuccore/LC528137 Pimpinella stewartii (C.B. Clarke) Nasir rbcL LC527457 https://www.ncbi.nlm.nih.gov/nuccore/LC527457 Cotoneaster frigidus var. affinis (Lindl.) Wenz.Ycf3LC598715 https://www.ncbi.nlm.nih.gov/nuccore/LC598715
RpoB LC598891 https://www.ncbi.nlm.nih.gov/nuccore/LC598891 Zanthoxylum armatum DCITS2LC532160 https://www.ncbi.nlm.nih.gov/nuccore/LC532160
BLAST, a similarity-based algorithm, was used to authenticate species by matching query sequences to reference databases, with identification considered successful at ≥ 97% sequence identity and query coverage. The BLAST results helped refine morphological identifications, with our samples showing at least 98% similarity to reference sequences. In this study, newly generated ITS2, rbcL, trnH-psbA, trnA, and rpoB sequences demonstrated 100% query coverage, confirming high accuracy in species identification (Table 6).
Table 6The result of BLAST identification of candidate barcode regions.SpeciesBarcode regionMax. scoreTotal scoreQuery coverage%E. valueIdentity %Aquilegia pubiflora Wall. ex Royle. rbcLa 525525638e-11597 rpoB 87687610000100 trnV 103810389900100 Ycf3 11791179990099.24Abelia triflora R.Br. ex Wall. trnA 67667610000100 rbcLa 9689689900100 trnV 9119111000099.91Spiraea hazarica R.Parker trnA 5825821003e_16299.69 trnV 1018101810000100 rbcLa 968968990099.62Cotoneaster frigidus var. affinis (Lindl.) Wenz. Ycf3 896896990093 rpoB 6856851000099.60Bistorta affinis (D.Don) Greene trnA 496496994e-136100Jasminum leptophyllum Wall. ex G.Don matK 116811681000094.92 rbcLa 9249241000099. rpoB 7217211000097 trnA 579579990098 trnV 9619611000098 Ycf3 110311031000098.71Anemone obtusiloba D.Don trnH-psbA 7197199900100ITS21133113310000100 rbcL 2289228910000100Thalictrum secundum Edgew. rbcL 136913698800100Bupleurum lanceolatum Wall. ex August. rbcL 149814989900100 matK 278278800086Coriaria nepalensis Wall. rbcL 192719279400100Delphinium cashmerianum Royle rbcL 931931810099 trnH-psbA 412412709e-11189Daphne papyracea Wall. ex Steud. rbcL 121412148400100 trnH-psbA 1038103810000100Desmodium elegans DC rbcL 19141914910096.94Deutzia staminea R.Br. ex Wall. rbcL 228122811000099.84 matK 18331833880092Dioscorea balcanica Kosanin matK 150915091000099.52Epimedium elatum C.Morren. trnH-psbA 9319311000098.49ITS21188118810000100 rbcL 152615261000097.96Galium tetraphyllum. Nazim. & Ehrend. rbcL 18341834910092 trnH-psbA 129512959900100 matK 534534832e-14785Heracleum polyadenum Franchet rbcL 1118111810000100Impatiens edgeworthii Hook.f.ITS218681868760099.84 rbcL 11181118920095.65 trnH-psbA 580580900093.38 matK 675675720082.40Incarvillea emodi Chatterjee rbcL 220022001000099.76Lonicera japonica Thunb. rbcL 175517551000099Phytolacca latbenia (Moq.) H.Walter. matK 13951395990098 rbcL 2244224410000100ITS2114911491000099Pimpinella stewartii (C.B. Clarke) Nasir rbcL 1519151910000100Aesculus indica (Wall. ex Cambess.) Hook. trnH-psbA 8178171000098.70 rbcL 196419641000099Thymus linearis Benth. trnH-psbA 599599980094 rbcL 15441544980095Swertia ciliata Roxb. ex Fleming. matK 13251325960099 rbcL 8268261000099.59 trnH-psbA 625625938e-17594.47Rhododendron lepidotum Wall. ex Hook.f. trnH-psbA 579579736e-16198.64 matK 11621162980095.78 rbcL 104410441000099.82Potentilla erecta (L.) Raeusch. matK 12251225990097.24 trnH-psbA 486486894e-13389.97Rhamnus parvifolius Bunge. trnH-psbA 5565561003e-15490.97ITS210141014930096 matK 12731273990099 rbcL 941941620097.48Arisaema utile Nakai rbcL 1496149610000100 matK 606606890099Bistorta amplexicaulis (D.Don) Greene matK 90090010000100 trnH-psbA 8118119900100 rbcL 186418641000099.90Zanthoxylum armatum DC. Rbcl 1124112410000100 trnH-psbA 4504501000095.62ITS21059105997100
Species discrimination and identification success were further assessed using the Best Match (BM) and Best Close Match (BCM) functions in Taxon DNA (Species Identifier 1.7.7), based on sequence similarity across all recovered barcode regions. Results showed that rbcL and trnH-psbA provided the highest correct recognition rates, with BM values of 84.6% and 75.0%, respectively (Table 7).
Table 7Comparative success rate of used species based on best-match, best-close match of DNA Barcode analyses by using species identifier 1.7.7.SpeciesDNA barcode regionBest-MatchBest-close-matchAll species barcodeCorrect %Incorrect %Ambiguous %Correct %Incorrect %Ambiguous %Correct %Incorrect %Ambiguous %Anemone obtusiloba D.Don trnH-psbA 44302580131305812ITS220783402230210079 rbcL 60316484300000043Arisaema utile Nakai matK 321058005050003080 rbcL 802000203050501040Bistorta amplexicaulis (D.Don) Greene matK 603010405526336750 trnH-psbA 752500006336324624Bupleurum lanceolatum Wall. ex August. rbcL 82910307000460070Coriaria nepalensis Wall. rbcL 780000801731000080Delphinium cashmerianum Royle rbcL 85916614469293544 trnH-psbA 604915005415000062Desmodium elegans DC rbcL 781335002500000025Daphne papyracea Wall. ex Steud. rbcL 824100560000000000Deutzia staminea R.Br. ex Wall. matK 332773002764000091 rbcL 405100003300450033 Dioscorea balcanica Kosanin
matK 27677271300001327Epimedium elatum C.Morren.ITS2302575000075000075 trnH-psbA 108614005714110071 rbcL 395021391848000000Galium tetraphyllum. Nazim. & Ehrend. rbcL 441300007700000077 matK 00900002200001111 trnH-psbA 560044002211003300Heracleum polyadenum Franchet rbcL 406040004000004000Impatiens edgeworthii Hook.f.ITS2341551000000000000 matK 208000002200000022 rbcL 416733005000000034Incarvillea emodi Chatterjee Rbcl 684100000000000000Lonicera japonica Thunb. rbcL 830017000000000000Phytolacca latbenia (Moq.) H.Walter.ITS200928002300002300 matK 364000004000000060 rbcL 410000501040410000Pimpinella stewartii (C.B. Clarke) Nasir rbcL 580042400000403031Potentilla erecta (L.) Raeusch. matK 10900000200000002trnH-psbA442000442000000000Aesculus indica (Wall. ex Cambess.) Hook. rbcL 550049400050550050Rhamnus parvifolius Bunge. rbcL 336700330000000033ITS2001200007500000075Rhododendron lepidotum Wall. ex Hook.f.ITS2550046003020005050 rbcL 652015650035500050 trnH-psbA 503120503120604000 matK 425010304030505000Swertia ciliata Roxb. ex Fleming. matK 37503505000000000 rbcL 571546190034637 trnH-psbA 3612360000235021Thalictrum secundum Edgew., rbcL 6620062124237600Thymus linearis Benth. trnH-psbA 492800492800316700 rbcL 50302050200425700Jasminum leptophyllum Wall. ex G.Don rbcLa 265031204039007030 Ycf3 3250200000100307000 rpoB 002575003725007900 trnV 00001000010000000000 trnA 206020007030005050Abelia triflora R.Br. ex Wall. trnV 100000000000000000 trnA 1010900010000102150 rbcLa 36620036620080500Spiraea hazarica R.Parker trnV 1750002700000000100 trnA 90000000000000098 rbcLa 514010510000000061Cotoneaster frigidus var. affinis (Lindl.) Wenz. Ycf3 63800440000110021 rpoB 330000150000000000 Aquilegia pubiflora Wall. ex Royle
trnV 241650200000360000 rpoB 4365744130065002 rbcLa 446600620000390000 Ycf3 10000015420310017 trnV 37260042190040000Bistorta affinis (D.Don) Greene trnA 3050130010000610013Zanthoxylum armatum DC. rbcL 330000000000000000 trnH-psbA 61300210000000000ITS2005000000000000000
The interspecific and intraspecific distances were calculated for distance-based analysis by using ExcaliBar software. DNA barcoding is considered efficient when there is a significant difference between interspecific and intraspecific divergence, and it is also known as the barcoding gap. The barcoding gap occurs when the maximum intraspecific distance is higher than the minimum interspecific distance. In the present study, a clear barcoding gap was found in trnH-psbA, followed by matK and rbcLa (Table 8).
Table 8Descriptive table showing Inter and intraspecific distances on the basis of Kimura 2 parameter.Genetic distancerbcLmatKtrnH-psbAITS2trnVtrnArpoBYcf3rbcLaMax. Intraspecific distance0.690.390.710.040.310.010.000000.06Min. intraspecific distance0.0000.000.34000.110.060.0000000Max. interspecific distance0.7480.110.710.570.4610.710.710.660.70Min. interspecific distance0.210.410.900.160.060.030.000.010.11
For phylogenetic analysis, some reported reference sequences were retrieved from the GenBank database (http://www.ncbi.nlm.nih.gov/genbank/). The phylogenetic analysis was performed using the Neighbour-joining method in MEGA 6. Overall, the phylogenetic tree based on various tested barcode regions showed strong node support and had a powerful resolution between species to differentiate the relationship. In the Neighbour joining tree method, all the candidate barcodes had different degrees of resolution power, but some had similar topology. Among all tested barcode regions, the ITS2 showed slightly low level of resolution power. In some cases, the tested barcode regions showed strong discrimination power but failed to delineate true species boundaries. Some species within the same genus were found in clusters, while others fell outside and occurred in a dispersed form, representing the studied species as an outgroup. The Pairwise Genetic Distance Matrix represented the Evolutionary divergence of the targeted species and the NCBI retrieved species.
The ITS2 sequence based phylogeny showed the relationship of query species with reference database sequences, among (LC511740.1-Anemone obtusiloba) clustered with (LC554188.1-Anemone obtusiloba) with bootstrap of 89, (LC510570.1-Epimedium elatum) with (JN010975.1-Epimedium elatum), (LC527449.1-Impatiens edgeworthii) with (JX524787.1-Impatiens glandulifera),* (LC527456.1-Phytolacca latbenia) with (OL824848.1-Phytolacca latbenia Walter), (LC528221.1- Rhamnus parvifolius) with (AY626439.1-Rhamnus purpurea*), and (LC532160.1 zanthoxylum armatum) with (MH016484.1-zanthoxylum armatum) with a strong bootstrap support of 69, 75, 82, 86, and 87 showed in Fig. 2.
Fig. 2Cladogram showing the phylogenetic or evolutionary relationships of endemic flora with database sequences based on the ITS2 primer, which confirms the identification at family, genus, and species levels with strong bootstrap support.
The matK based phylogeny showed the relationship of (LC521897.1-Bistorta amplexicaulis) with (KP172064.1-Rydingia limbata), (LC521900.1- Bupleurum lanceolatum) with (MF694831.1-Bupleurum falcatum), and (MK926096.1-Bupleurum rotundifolium), (LC527407.1-Deutzia staminea) with (MH659280.1-Deutzia parviflora), (LC527409.1-Dioscorea balcanica) with (LC327678.1-Dioscorea bulbifera), (LC527451.1-Impatiens edgeworthii) with (KX677366.1-Impatiens glandulifera), (LC527454.1-Phytolacca latbenia) with (MH659547.1-Phytolacca acinosa), and (LC528225.1-Rhododendron lepidotum) with (JF956003.1-Rhododendron lepidotum), while (LC527447.1-Galium tetraphyllum), and (LC528137.1-Potentilla erecta) with the member of genus Rhamnus with bootstraps of 44, 57, 96, 98, 99, and 100 showed in Fig. 3.
Fig. 3Cladogram showing the phylogenetic or evolutionary relationships and genetic diversity of the endemic flora, with database sequences based on the chloroplast matK primer, confirming a high identification success rate at the family, genus, and species levels with strong bootstrap support.
Similarly, phylogeny based on trnH*-psbA sequences, the query sequences of (LC511742.1-Anemone obtusiloba) share clade with (LC554187.1-Anemone obtusiloba), (LC516690.1-Aesculus indica) with the member of genus Aesculus, (LC521898.1-Bistorta amplexicaulis) with (EF633739.1-Bistorta amplexicaulis*), (LC527403.1-Delphinium cashmerianum) with (OK148444.1-Delphinium montanum), (LC511739.1-Epimedium elatum) with Epimedium spp, (LC528220.1-Rhamnus parvifolius) with (KP299593.1-Rhamnus sphaerosperma), (LC528224.1-Rhododendron lepidotum) with (JN046857.1-Rhododendron lepidotum), (LC528387.1-Swertia ciliata) with Swertia spp, and (LC528389.1-Thymus linearis) with bootstrap of 84 to 100 showed in Fig. 4.
Fig. 4Cladogram showing the phylogenetic or evolutionary relationships and genetic diversity of the endemic flora, based on database sequences generated with the chloroplast trnH-psbA primer, confirming a high identification success rate at the family, genus, and species levels with strong bootstrap support.
In phylogeny based on rbcL sequence of query sequences showed relationship of (LC516689.1-Asculus indica) with (PP809764.1-Asculus polyneura) with bootstrap of 84, (LC521896.1-Arisaema utile) with (NC064687.1-Arisaema decipiens) and (KJ773277.1-Arisaema dracobtium) with bootstrap of 60,* (LC521899.1-Bistorta amplexicaulis*) with (EF653765.1-Bistorta amplexicaulis), and (FM883606.1-Bistorta amplexicaulis) with bootstrap of 64, (LC521901.1-Bupleurum lanceolatum) with (OR508826.1-Bupleurum marginatum) with bootstrap of 83, (LC527402.1-Delphinium cashmerianum) with (OK148444.1-Delphinium montanum) with bootstrap of 11, (LC527404.1-Dephne papyracea) with (MG833726.1-Dephne bholua) with bootstrap of 72, (LC527408.1-Deutzia staminea) with (NC057286.1-Deutzia glabrata) with bootstrap of 09, (LC511738.1-Epimedium elatum) with (MW483094.1-Epimedium elatum) with bootstrap of 11, (LC527448.1-Heracleum polyadenum) with (HK518827.1-Heracleum maximum) with bootstrap of 53, (LC527450.1-Impatiens edgeworthii) with (AB043532.1-Impatiens amplexicaulis) with bootstrap of 34, (LC527452.1-Incarvillea emodi) with (JQ933368.1-Incarvillea emodi) with bootstrap of 53, (LC527453.1-Lonicera japonica) with (OP388439.1-Lonicera angustifolia) with bootstrap of 45, (LC527455.1-Phytolacca latbenia) with (NC041113.1-Phytolacca insularis) with bootstrap of 44, (LC528323.1-Rhamnus parvifolius) with (AM235104.1-Rhamnus prinoides) and (ON009012.1- Rhamnus globose) with bootstrap of 57, (LC528386.1-Rhododendron lepidotum) with Rhododendron spp, (LC527457.1-Swertia cilita) with Swertia spp, (LC528388.1-Thalictrum rochebruneanum) with (JX258372.1-Thalictrum macrocarpum) with bootstrap of 56, (LC528390.1-Thymus linearis) with Thymus spp, and (LC527406.1-Ototropis elegans) with (MN267864.1-Semenovia transiliensis) and (NC064353.1-Tordyliopsis brunonis) with bootstraps of 32 showed in Fig. 5.
Fig. 5Neighbour-Joining tree showing the phylogenetic or evolutionary relationship and genetic diversity of endemic flora with database sequences based on chloroplast rbcL primer, which confirm the identification success rate at family, genus and species.
The present study represents the first comprehensive multilocus DNA barcoding effort targeting endemic plant species of the Western Himalayan biodiversity hotspot in Pakistan. This region, although floristically rich, is highly vulnerable to climate change, glacier melting, soil erosion, landslides, habitat fragmentation, and anthropogenic pressure^70,71^. Endemic flora are particularly susceptible due to their restricted geographic distribution, medicinal exploitation, and limited conservation management^72^. In this context, accurate molecular identification is essential for documenting and safeguarding regional plant diversity^73^.
In the current study, a total of 32 endemic species of 31 genera belonging to 24 families were molecularly characterized to establish a reference DNA barcode library. DNA barcoding provides a rapid and standardized approach for species authentication using short genomic rather than whole genomes^74^. This technique has proved to be a rapid, cost effective, and accurate method for species identification^75^. This technique was initially applied in biodiversity records, molecular systematics, and wildlife forensic^76,77^.
Nine loci (trnH*-psb*A, rbcL, matK, ITS2, rbcLa, trnA, trnV, ycf3, and rpoB) were evaluated amplification efficiency, sequencing success, and discriminatory power. Among these, rbcL and trnH-psbA showed the highest amplification and sequencing success rates, followed by matK. ITS2 showed comparatively lower sequencing efficiency, consistent with challenges commonly reported for nuclear ribosomal in plants.
Potential DNA barcode selection based on amplification, sequencing, and resolving the taxonomic uncertainties is a crucial step in accurate species identification^78^. Quantitative species discrimination analysis demonstrated that rbcL and trnH-psbA achieved the highest identification success under Best Match (BM) and Best Close Match (BCM) criteria. The combined loci e.g., rbcL + matK improved species resolution compared to single markers, supporting the CBOL recommendation of rbcL + matK as core barcode^79,80^.
The non-coding intergenic sequence trnH*-psbA has widely used in phylogenetic analysis because of its high substitution rate^81^. In the present study, trnH-psbA was observed to be an effective marker after rbcL for amplification and sequencing, as well as for sequence recovery. Similarly, trnH-psbA showed 100% success in amplification and sequencing compared with the ITS and matK gene regions^82^. Similarly, in previous studies, the trnH-psb*A revealed 97.05% amplification success rate and 92.02% the sequencing success rate^83^.
Analysis of Kimura 2-parameter (K2P) distances revealed clear interspecific divergence exceeding intraspecific variation in most taxa, indicating the presence of barcode gap for the majority of species. However, a few closely related congeners exhibited overlapping intra-and interspecific distances, explaining cases of reduced resolution^84^.
The molecular data helped clarify identification in several morphologically similar taxa within families such as Ranunculaceae, Apiaceae, Rosaceae, and Caprifoliaceae. In certain cases, preliminary morphology-based identification required re-evaluation after BLAST and phylogenetic analysis indicated alternative placements consistent with reference sequences.
For example, closely related taxa within Apiaceae and Rosaceae that exhibit overlapping vegetative characters were more reliably separated using multilocus data. Instances of low interspecific divergence suggest possible recent speciation events or the need for additional markers in specific genera. No strong evidence of deep cryptic divergence was detected, although a few taxa warrant further population-level study.
These finding demonstrate how DNA barcoding reduces misapplied names, strengthens herbarium voucher authentication, and refines species boundaries in morphologically complex Himalayan taxa.
Phylogenetic analysis conducted using Neighbour-Joining method through Mega software version 11^85^, with appropriate substitution models and bootstrap support values, confirmed clustering patterns largely consistent with current taxonomic classification at family and genus level. Nodes with bootstrap support > 50% were retained for interpretation, and several clades showed strong statistical support. However, the plastid loci rbcL and trnH*-psb*A provided stable backbone resolution, while ITS2 contributed additional variation at lower taxonomic levels when successfully amplified. A concatenated multilocus dataset improved overall tree resolution compared to single-locus trees^86^.
DNA barcoding is a widely accepted method to evaluate a suitable barcode region^87^. However, in Best Match, Best Close Match, and species barcode, the highest rate was observed for rbcL and trnH*-psbA, followed by matK and rbcLa. The rbcL was the most suitable DNA barcode region at genus level identification, followed by trnH-psb*A in species identification, while other barcode regions showed moderate results in identification, consistent with the previous study of^88^.
A total of 32 endemic plants of 31 genera belonging to 24 families were molecularly characterized and identified at genus, species, and family-level through DNA barcoding, such as Thalictrum secundum, Aquilegia pubiflora, Anemone obtusiloba, and Delphinium cashmerianum of family (Ranunculaceae), Pimpinella stewartii (Umbeliferaceae^89^, Bistorta amplexicualis (Polygonaceae)^90^. Abelia triflora and Lonicera japonica (Caprifoliaceae)^91^, Aesculus indica of family (Spindaceae), Arisaema utile of (Arecaceae)^92^, Coriaria and Coriari nepalensis (Coriaracea), Desmodium elegans (Papilionacea), Dephni papyraceae of family (Thymelaceae)^93^, , Epimedium elatum (Berberidaceae)^94^, Galium tetraphyllum (Rubiaceae)^95^. Bupleurum lanceolatum and Heracleum polyadenum (Apiaceae)^96^, Impatiens edgeworthii, (Balsiminaceae), Incarvelea emodi (Bigononiacea). Potentilla erecta,* Cotoneaster Cotoneaster frigidus var. affinis* and Spirae hazarica from family (Rosaceae)^97^, Phytolaca latbenia, (Phytolacacea), Rhamnus parvifolius (Rhamnaceae)^98^, Thymus linearis (Labiateae)^99^, Jasminum leptophyllum (Oleaceae)^100^, Rhododendron lepidotum (Ericacea)^101^, Swertia ciliata (Gentianaceae)^102^, Zanthoxylum armatum (Rutaceae)^103^, Dioscorea balcanica (Dioscoreaceae)^104^, and Deutzia staminea (Hydrangeaceae)^105^.
Accurate species identification is fundamental for conservation planning. Misidentification of endemic or threatened plants can lead to flawed red list assessments, inappropriate conservation priorities, and ineffective protected-area management. By establishing a validated barcode reference library for 32 endemic species, this contributes molecular tools for (i) verification of threatened taxa in Red List evaluations, (ii) Monitoring of medicinal plant trade and prevention of adulteration, (iii) supporting protected-area biodiversity inventories, and (iv) detecting taxonomic ambiguities before conservation decisions. In a biodiversity hotspot such as the western Himalaya, integrating molecular authentication with traditional taxonomy enhances long-term conservation strategies and strengthens evidence-based biodiversity management.
In conclusion, the current study is the first molecular systematic investigation of the endemic flora of the western Himalayan region of Pakistan. Thirty two species were investigated, and different multi-locus markers such as ITS2, matK, rbcL,* rpoB*, trnA, trnV, trnH*-psb*A, and ycf3 were applied to check the basic criterion of amplification, sequencing, and species discrimination. Among the tested candidate barcode rbcL showed the highest success rate in amplification and sequencing, followed by trnH-psbA, and matK. At the same time, the remaining primers showed amplification rates greater than 60% in amplification, sequencing, and identification. Overall, DNA barcoding has demonstrated the taxonomic uncertainties in the available flora at the family, genus, and species levels.