Authors: Sanwei Gu, Jian Zhang, Xiaoye Fan, Huacan Liu, Huaizhi Yang, Ying Ding, Xuming Deng, Lei Song, Yanhong Deng, Tingting Wang
Categories: Article, Pathogens, Bacterial infection, Pharmacology
Source: Communications Biology
Authors: Sanwei Gu, Jian Zhang, Xiaoye Fan, Huacan Liu, Huaizhi Yang, Ying Ding, Xuming Deng, Lei Song, Yanhong Deng, Tingting Wang
Streptococcus pneumoniae (S. pneumoniae) remains a predominant cause of high morbidity and mortality in childhood and the elderly, despite the widespread pneumococcal conjugate vaccines (PCVs) vaccination through the world. The critical role of capsule in the pathogenicity of S. pneumoniae makes it an attractive drug target for alternative strategies to combat antibiotic-resistant and non-vaccine serotype infections. Here, we identified the natural compound molecule stevioside as an effective capsule inhibitor that reduces the biosynthesis of capsular polysaccharide through interfering with pyruvate metabolism and subsequent disruption of bacterial NAD + /NADH redox balance and energy generation. In vitro, the compound significantly sensitized streptococci to stress attacks and the killing of antibacterial peptides (AMPs). Meanwhile, capsule-mediated resistance to complement deposition, epithelial adherence and phagocytosis were all remarkably attenuated by stevioside. In vivo, stevioside treatment systematically protected mice from lethal streptococcal pneumoniae, as evident by an increased survival rate, alleviated pathological damage and inflammation level. Overall, the study provides stevioside as a promising lead compound for the further development of chemical capsule inhibitors aimed at curbing S. pneumoniae infections, and reveals a novel strategy for the discovery of S. pneumoniae capsule inhibitors based on pyruvate metabolism pathways.
Streptococcus pneumoniae (S. pneumoniae) remains the leading bacterial pathogen responsible for substantial mortality and morbidity worldwide. Although the gram-positive opportunistic bacterium commonly colonizes the upper respiratory tract as a commensal in healthy individuals, it also spreads from the nasopharynx to other parts of the body and causes sinusitis, otitis media, as well as lethal diseases such as pneumonia, meningitis and septicemia, particularly in immunocompromised patients, children <5 years old and the elderly^1^. Every year, pneumococcal diseases cause more than 3 million hospitalizations globally, resulting in hundreds of thousands of deaths^2^. According to a recent report on the worldwide analysis of lower respiratory tract infections, S. pneumoniae- associated cases accounted for 1,189,937 deaths, which was more than all other etiologies combined in 2016^3^. Despite that the widely introduction of capsule-conjugated vaccines has reduced the incidence of pneumococcal diseases by 2- to 4-fold for the included serotypes, S. pneumoniae was still listed as a “priority” pathogen posing the greatest threat to human health by WHO in 2017 due to increasing antibiotic resistance and the inevitable gap in vaccine serotypes^4^. In fact, a recent global systematic analysis of bacterial antibiotic resistance revealed that S. pneumoniae ranked as the fourth-leading cause of death associated with antibiotic resistance^5^. Therefore, there is a constant need for the development of novel alternative strategies to curb S. pneumoniae infections.
Similarly to other gram-positive pathogenic bacteria, such as Staphylococcus aureus and Listeria monocytogenes, S. pneumoniae also produce a wide array of virulence determinants for adhering to tissues, invading cells and breaking through the physical, immunological and functional barriers of host during infection. For example, the cholesterol-dependent pore-forming cytolysin pneumolysin (PLY) is exploited to promote colonization, transmission and dissemination through multifaceted mechanisms, including permeabilizing the host cell plasma membrane, mimicking ligands for host molecules and triggering multiple cellular events^6^. By contrast, the pneumococcal adhesins and virulence proteins A (PavA) and B (PavB), as well as pili, are primarily involved in bacterial adherence to host cells by mediating pneumococcal binding to immobilized fibronectin^7^. In addition, S. pneumoniae express the pyruvate oxidase SpxB to prolong colonization, boost bacterial replication, cause cellular cytotoxicity and facilitate competitive interactions with other commensals by producing H2O2^8,9^. Capsule, a critical virulence determinant for virous pathogens that commonly form the outermost layer of encapsuled bacterial, is undoubtedly the most principal virulence factor for the pathogenicity and immune evasion of S. pneumoniae, as evidenced by the significantly reduced colonization levels of nonencapsulated isolates^10^. The polysaccharide capsule is a dominant bacterial surface structure up to approximately 400 nm thick, which almost makes up half of the pneumococcal volume, and is usually covalently attached to the cell wall of gram-positive bacterial^11^. The diversity of capsular polysaccharide (CPS) in composition, thickness and structure is determined by the polysaccharide-specific cps locus that encodes the enzymes necessary for polysaccharide synthesis, including the modulation elements (Wzg, Wzh, Wzd and Wze), polymerase (Wzy) and transporter (Wzx flippase) in the Wzy-dependent pathway, as well as glycosyltransferases in the synthase-dependent mechanism^12^. To date, more than 100 CPSs distinct in serology and structure have been identified^13^, and approximately 70% of the chemical structures of repeat units in polysaccharides synthesized by the Wzy-dependent pathway have been determined using advanced analytical technologies, such as mass spectrometry (MS), gas-liquid chromatography and nuclear magnetic resonance (NMR).
Almost all pneumococcal CPSs are naturally negatively charged at physiological pH, which enables S. pneumoniae to repel the sialic acid-rich mucopolysaccharides and thus avoid the mucus entrapment and clearance during nasopharyngeal colonization^14^. Host complement system plays critical roles in the early control of bacterial invasion through triggering and coordinating both the innate and adaptive immune responses, and is therefore commonly referred to as the first line of defense against S. pneumoniae infections^15^. Although the complement system is activated by S. pneumoniae through three distinct mechanisms, including the classical pathway by C-reactive protein, C1q or antibodies, the mannose binding lectin (MBL) activation pathway by ficolin recognition, and the alternative pathway via direct interaction, it is unsurprising that S. pneumoniae has already evolved different strategies to resist complement^16^. Surrounding the cell wall at the outermost layer of S. pneumoniae, capsule prevents complement deposition and impedes opsonophagocytosis by blocking the interactions of bacterial surface-bound C3b/iC3b or the Fc regions of immunoglobulins with their cognate receptors on phagocytes^17^. Thus, S. pneumoniae strains with low levels of or deficiency in capsule would be rapidly opsonized by serum factors and cleaned by immune cells. In addition, capsule also protects S. pneumoniae from the killing by host antimicrobial peptides (AMPs)^18^. Importantly, capsule accelerates disseminated S. pneumoniae infection by impairing bacterial adhesion and invasion of nonimmune cells due to its negative charge^19^. Moreover, the protective structure also promotes pathogenesis through hindering the entrapment of pneumococci by neutrophil extracellular traps via inhibiting the activation of signaling pathways involved in phagocytosis, and by impairing the TLR2 recognition of related ligands expressed by S. pneumoniae and thereby impeding MyD88-mediated antibacterial responses^20,21^.
The indispensable role of capsule in the pathogenicity of S. pneumoniae renders it an attractive target for drug development. Indeed, CPS-based vaccine was first licensed in the 1970s and up to now, capsule is still the preferred target for vaccine design. The currently available CPS vaccine contains up to 23 of the 100 identified serotypes, which provides effective but serotype-limited protection against invasive S. pneumoniae infections. Unfortunately, the distribution of epidemic strains with different serotypes varies both geographically and temporally, resulting in a considerable but inevitable gap in serotype coverage. For example, the current 23-valent vaccine covers 85–90% of clinical associated serotypes in Europe and the United States, but in Asia, the coverage is less than 60%^22^. Compared to vaccines, the chemical inhibitors avoid serotype-specific problems and thus represent a promising therapeutic to combat pneumococcal diseases, but so far, there is no effective capsule inhibitor available. Herein, we performed capsule-targeted biochemical screening and identified stevioside (STE), a natural organic molecule extracted from the scrub plant Stevia rebaudiana, as a potent inhibitor of S. pneumoniae capsule. Further studies revealed that stevioside suppressed CPS synthesis through modulating bacterial pyruvate metabolism. By reducing capsule production, the compound significantly reduced capsule-mediated resistance to the killing of antimicrobial peptides, the lethal acidic conditions and strong oxidative stress that mimicked lysosomal killing. Moreover, stevioside significantly enhanced the deposition of complement molecules on the bacterial surface through inhibiting capsule, and capsule-mediated resistance to host cell adherence and phagocytosis were both attenuated. Accordingly, stevioside treatment effectively protected mice from lethal streptococcal pneumonia, as evident by increased survival rate, decreased bacterial burden and alleviated pathological damage and inflammation. Overall, our study provides the natural compound stevioside as a promising S. pneumoniae capsule inhibitor with potential therapeutic effects against S. pneumoniae infections.
Given that capsule plays a central role in the virulence of S. pneumoniae and no effective chemical inhibitors have been identified up to now, we screened potential capsule inhibitors from the small molecule library containing 800 compounds and successfully identified stevioside (Fig. 1A), a natural compound derived from stevia, as the most promising one. Although, a previous study demonstrated that stevioside exhibited antimicrobial activity against Bacillus subtilis, Klebsiella pneumoniae and Salmonella typhimurium^23^, our result confirmed that the compound showed no effect on S. pneumoniae growth (Fig. 1B, C). The uronic acid-based analysis of polysaccharide content revealed that stevioside dose-dependently reduced the capsule polysaccharide production of S. pneumoniae (Fig. 1D), and such a significant decrease was also determined by the phenol-sulfuric acid method (Fig. 1E). FITC-dextran exclusion assay intuitively confirmed that stevioside indeed caused a significant decrease in capsule thickness (Fig. 1F). Moreover, electron microscopy observation provided additional experimental evidence that the active compound effectively reduced both the amount and density of the polysaccharide capsule surrounding the surface of D39 streptococci, accompanied by a significant decrease in the chain length, as well as the appearance of heterogeneity and sparse particle structures (Fig. 1G). Importantly, such inhibition effect occurred whether under nutritious cell cultivation condition or other alternative culture medium for S. pneumoniae (Figs. 1H and 1I). Then, we further performed uronic acid assay on other strains with different serotypes to explore whether the inhibitory effect of stevioside on capsule was serotype specific. Promisingly, the capsule production of all the tested strains, including serotype 1, 6 A, 22 F, 5 and 6B, were all dose-dependently suppressed by stevioside (Fig. 1J), indicating that the compound might be a broad-spectrum S. pneumoniae capsule inhibitor. Taken together, these results demonstrated that stevioside is an effective S. pneumoniae capsule inhibitor without affecting bacterial viability.Fig. 1Stevioside inhibited S. pneumoniae capsular polysaccharide synthesis without affecting bacterial viability.A Diagram for the procedure identifying stevioside as a capsule inhibitor based on uronic acid assay. B Growth curves of S. pneumoniae D39 in the presence of DMSO or indicated concentrations of stevioside. C CFUs counting of S. pneumoniae at indicated time points during the growth curve determination period. D Quantification of capsule production by uronic acid assay. Capsular polysaccharides were extracted from S. pneumoniae D39 strain treated with DMSO or indicated concentrations of stevioside and analyzed using uronic acid assay. E Validation of capsule reduction by the phenol-sulfuric acid method. F The capsule of S. pneumoniae D39 treated with DMSO or indicated concentrations of stevioside was visualized by the dextran exclusion assay. The red arrows indicate capsule. Scale bars, 5 µm. G Transmission electron micrographs of S. pneumoniae D39 treated with DMSO or indicated concentrations of stevioside. The blue arrows indicate capsule. Scale bars, 1 µm and 0.5 µm. H Quantification of capsule production by uronic acid assay under cell cultivation condition. S. pneumoniae D39 strain were cultured in RPMI 1640 medium containing 10% FBS with the treatment of DMSO or indicated concentrations of stevioside for uronic acid assay. I Quantification of capsule production by uronic acid assay under other alternative culture medium for S. pneumoniae. S. pneumoniae D39 strain were cultured in C + Y medium with the addition of DMSO or indicated concentrations of stevioside for uronic acid assay. J Capsule production of different S. pneumoniae strains treated with DMSO vehicle or indicated concentrations of stevioside. All data from three technical replicates (B, C) or biological replicates were presented as mean ± SD. One-way ANOVA and Tukey’s posttest were performed to analysis the statistical significance of different groups. *P < 0.05, **P < 0.01, and ns no significance compared with the DMSO control group.
Although several genes have been identified as the regulators of cps locus^24,25^, accumulating evidence suggests that bacterial metabolism plays an indispensable role in regulating capsule polysaccharide biosynthesis when encountering diverse environments during colonization and invasion^26–28^. Therefore, we performed metabolomics analysis to explore the mechanism of stevioside reducing polysaccharide capsule biosynthesis. As illustrated by partial least squares discrimination analysis (Fig. 2A), the metabolome of stevioside-treated streptococci was significantly separated from the control group (PC1 was 22.7%, and PC2 was 21.1%). We identified 202 significantly differential metabolites in stevioside-treated streptococci by comparison with vehicle-treated streptococci, with 88 metabolites more abundant and 114 metabolites downregulated (Fig. 2B). Notably, these significant differentially expressed metabolites were identified by considering both the P-value (P < 0.05) and variable importance in the projection (VIP > 1). Heatmap-based clustering analysis of those differential metabolites further revealed the significant difference between stevioside- and vehicle-treated streptococci (Fig. 2C). Building upon these key metabolites, KEGG pathway enrichment analysis yielded the top 20 most affected metabolic pathways, 10 of which were involved in amino acid metabolism, and 4 pathways were associated with the metabolism of cofactors and vitamins (Fig. 2D). In addition, our analyses also identified enriched pathways in nucleotide metabolism, carboxylic acid metabolism, and the biosynthesis of various other secondary metabolites. Consistent with the results of the initial differential metabolite identification, network analysis revealed that pyruvate was the central metabolite connecting those enriched metabolic pathways (Fig. 2E), and the level of this intermediate metabolite significantly decreased in most pathways (14/20), especially those involved in amino acid metabolism. Accordingly, the pronounced alteration in pyruvate ranked upstream among the top 20 differential metabolites (Fig. 3A).Fig. 2Stevioside significantly altered the metabolic profile of *S. pneumoniae.*A Clustering of samples within the PLS-DA principal component of S. pneumoniae D39 strain with the treatment of DMSO or 64 μg/ml stevioside. The X-axis and Y-axis represent the percentages of the contributions of the first two principal components (PC1 and PC2) (n = 5). B Volcano plots analysis of differently identified metabolites in S. pneumoniae D39 treated with DMSO or 64 μg/ml stevioside. C Heatmap of bacterial metabolites that differed between DMSO- and stevioside-treated S. pneumoniae D39. D KEGG enrichment analysis of identified different metabolites compared to the DMSO control group. E Summary network analysis of metabolomics data for the cluster showing interactions between the differentially identified metabolites. The data are presented as the means ± SD. One-way ANOVA and Tukey’s posttest were performed to analysis the statistical significance of different groups. *P < 0.05, **P < 0.01, and ns, no significance compared with the DMSO control group.Fig. 3Stevioside suppressed S. pneumoniae capsule production via decreasing pyruvate accumulation and subsequent disrupt of bacterial NAD + /NADH redox balance and energy generation.A Hierarchical clustering analysis of streptococcal metabolites that were significantly different between stevioside- and the DMSO-treated group (top 20, n = 5). B Pyruvate levels of streptococci with indicated treatments were determined using the Amplex Red Pyruvate Assay Kit. C The NAD + /NADH ratio in S. pneumoniae D39 treated with DMSO or indicated concentrations of stevioside. D Intracellular ATP levels in S. pneumoniae D39 treated with vehicle or indicated concentrations of stevioside. E Quantification of capsule production by uronic acid assay. Total uronic acid samples were extracted from wild-type D39, spxB-deficient D39 or wild-type D39 co-incubated with 5 mM pyruvate in the presence of DMSO or indicated concentrations of stevioside and analyzed using uronic acid assay. F–I The transcriptional levels of capsule synthesis genes cpsA (F), cpsC (G), cpsD (H) and cpsE (I). All data from three biological replicates were presented as mean ± SD. One-way ANOVA and Tukey’s posttest were performed to analysis the statistical significance of different groups. *P < 0.05, **P < 0.01, and ns no significance compared with the DMSO control group.
As a lactic acid bacterium, S. pneumoniae highly rely on glycolysis and fermentation for energy production due to their deficiency in both respiratory electron transport and an intact TCA cycle^29^, and the pyruvate cycle routinely functions as a common mechanism for energy generation and environmental fitness^30^. Increasing evidence reveals that three fermentation pathways involving pyruvate significantly influence S. pneumoniae colonization and the production of virulence determinants, especially capsule^27,31,32^. Therefore, we mainly focused on the differential metabolite pyruvate and further detected its intracellular level using the Amplex Red-based assay kit. Consistent with the metabolomic result, quantitative analysis confirmed that stevioside dose-dependently reduced intracellular pyruvate concentration in streptococci (Fig. 3B). Considering that fermentation of pyruvate is vital for maintaining a stable and available NAD + /NADH balance and thereby sustaining energy production, bacterial growth and survival encountering various environmental conditions^33,34^, we further analyzed the changes in NAD(H) pool and intracellular ATP in S. pneumoniae. Interestingly, stevioside treatment showed no effect on total NAD(H) pool, but the level of NADH was dose-dependently reduced, which in turn resulted in a significant increase in the NAD + /NADH ratio (Fig. 3C). Subsequent measurement of intracellular ATP level demonstrated that stevioide remarkably decreased the ATP pool compared to vehicle treatment, which also exhibited strong dose-dependency (Fig. 3D).
To elucidate the inherent correlation between stevioside-caused alteration in pyruvate metabolism and the decrease in capsule biosynthesis, we assessed the potential effect of stevioside on the capsule production of a mutant strain lacking pyruvate oxidase SpxB, and explored how exogenous pyruvate influences the inhibitory effect of stevioside on capsule production in wild-type D39. Intriguingly, the absence of spxB and the exogenous addition of 5 mM pyruvate both significantly eliminated the inhibitory effect of stevioside on capsule production (Fig. 3E), confirming that the chemical inhibitor definitely reduced capsule biosynthesis through interfering with pyruvate metabolism. This is not surprising, as capsule production is a high-energy cost process, and ATP levels are positively correlated with capsular polysaccharide production of S. pneumoniae^26,27,35^. Similarly, a recent study revealed that carbon source also exerts a significant effect on the capsule formation of Neisseria meningitidis, and pyruvate positively regulated its capsule biosynthesis via upregulating the relative expression of capsule genes^36^. Finally, we further analyzed the transcriptional levels of key genes involved in capsule synthesis. The qRT‒PCR data confirmed that the transcriptional levels of cpsA, cpsC, cpsD, and cpsE were significantly down-regulated by stevioside treatment (Fig. 3F–I). Taken together, these results demonstrated that stevioside suppressed S. pneumoniae capsule production via decreasing pyruvate accumulation and subsequent disruption of bacterial NAD + /NADH redox balance and energy generation.
Located at the outermost layer of encapsulated streptococci, the polysaccharide capsule facilitates S. pneumoniae survival in lethally acidic conditions, including lysosomal degradation and gastrointestinal stresses, and protects bacteria from the killing effects of reactive oxygen species (ROS). As speculated, stevioside significantly impaired capsule-mediated resistance to acid shock, as evidenced by the lower growth rate throughout the entire testing period (Fig. 4A). In addition, compared to vehicle-treated cells, stevioside-treated bacteria were more susceptible to H2O2-mediated killing in vitro (Fig. 4B). Collectively, these results suggested that stevioside sensitized S. pneumoniae to noxious stressors through inhibiting capsule, at least acid shock and oxidative stress.Fig. 4Stevioside reversed capsule-conferred stress resistance.A Growth curves of S. pneumoniae D39 in low pH (4.5) in the presence of DMSO or indicated concentrations of stevioside. B Bacterial viability of S. pneumoniae D39 in 10 mM H2O2 in the presence of DMSO or indicated concentrations of stevioside. All data from three technical replicates (A) or biological replicates were presented as mean ± SD. Unpaired two-tailed Student’s t-test was performed to determine the statistical significance of two groups. *P < 0.05, **P < 0.01 compared with the DMSO control group.
Host antimicrobial peptides play an indispensable role in the first line of innate immune defense against bacterial invasion, and it has been well established that the host antimicrobial cathelicidin peptide LL-37 has prominent antimicrobial activity against a broad spectrum of bacterial pathogens, including S. pneumoniae and multidrug-resistant K. pneumoniae^37^. However, capsular polysaccharide present on the bacterial surface also protects bacteria from AMP killing, because CPS can reduce the amount of peptide reaching the bacterial surface as a decoy^38^. Consistent with the obvious decrease in capsule thickness, stevioside effectively diminished capsule-conferred resistance of S. pneumoniae to the killing of LL-37 in a dose-dependent manner (Fig. 5A). Importantly, earlier work recognized that colistin, a peptide-related antimicrobial, shares a similar bacteria-binding mechanism and resistance strategy with LL-37^39^. Therefore, we further investigated whether stevioside altered the susceptibility of S. pneumoniae to colistin. Interestingly, although stevioside did not decrease the MIC of colistin against D39 S. pneumoniae (256 μg/ml), it significantly reduced cell survival in a time-killing assay (Fig. 5B). Overall, these results demonstrated that stevioside could partially promote bacterial clearance through subduing capsule-associated resistance to antimicrobial peptides.Fig. 5Stevioside attenuated capsule-mediated protection against the killing of antimicrobial peptides (AMPs).A The sensitivity of S. pneumoniae D39 to LL-37 in the presence of DMSO or indicated concentrations of stevioside was determined by CFU survival. B Bacterial survival of S. pneumoniae D39 in 128 and 256 μg/ml colistin in the presence of DMSO or 64 μg/ml stevioside was determined by CFU survival. All data from three biological replicates were presented as mean ± SD. One-way ANOVA and Tukey’s posttest were performed to analysis the statistical significance between different groups. **P < 0.01, and ns, no significance compared with the DMSO control group.
The complement system is an essential part of the host immune system, representing another crucial component in the first line of innate defense against S. pneumoniae invasion, whereas mounting evidence has elucidated that capsule indirectly hinders complement activation through preventing complement deposition and the binding of key complement mediators, such as IgG and C-reactive protein (CRP)^40^. Because the activation of all complement pathways triggers C3b generation and binding to the bacterial surface, as well as subsequent formation of C5b-9 membrane attack complexes (MACs), we further detected the deposition of these complement elements on the bacterial surface. As shown in Fig. 6, no visible fluorescence was observed in the samples directly incubated with antibodies without serum exposure, which ruled out the possibility of nonspecific binding. Meanwhile, D39 S. pneumoniae showed little to no C3b/iC3b deposition after 3 h of serum exposure, while stevioside remarkably increased the levels of C3b/iC3b (Fig. 6A, B). Consistently, a considerable increase in C5b-9 binding was also observed in the stevioside-treated group (Fig. 6C, D). These results suggested that stevioside promoted complement activation and thus might accelerate the immune clearance of S. pneumoniae by inhibiting capsule.Fig. 6Stevioside reduced capsule-mediated protection against the complement system.A Immunofluorescence microscopy analysis of C3b/iC3b deposition on the surface of S. pneumoniae D39 exposing to 20% NHS in the presence of DMSO or indicated concentrations of stevioside for 3 h. Cells were then rinsed and stained with APC-conjugated anti-C3b/iC3b antibody. A serum-free group served as a negative control to exclude the non-specific antibody binding. Scale bars, 10 µm. B The positive ratio of C3b/iC3b-stained bacterial cells was quantified by ImageJ. (n = 3). C Immunofluorescence microscopy analysis of C5b-9 complex formation on the surface of S. pneumoniae D39 exposed to 20% NHS in the presence of DMSO or indicated concentrations of stevioside for 3 hours. Bacterial were then rinsed and stained with a mouse anti-C5b-9 antibody and Alexa Fluor 488-conjugated goat anti-mouse IgG. Scale bars, 10 µm. D The ratio of C5b-9-positive bacterial cells was quantified by ImageJ. (n = 3). All data from three biological replicates were presented as mean ± SD and analyzed using unpaired two-tailed Student’s t-test. *P < 0.05, and ns, no significance compared with the DMSO vehicle group.
Capsule is also known for its indispensable role in immune evasion during S. pneumoniae infection, as the negatively charged polysaccharide capsule not only elevates bacterial dissemination by hindering adherence to epithelial cells^41^, but also protects bacteria from immune clearance by blocking phagocytosis and subsequent immune responses of host immune cells^42^. Thus, we further performed an adherence assay using A549 cells and a phagocytosis assay using mouse peritoneal macrophages (MPMs) and RAW 264.7 cells, respectively. As speculated, stevioside dose-dependently increased the number of attached bacteria, which achieved statistical significance at 8 μg/ml and caused a 10-fold increase at 64 μg/ml (Fig. 7A). Although, we performed phagocytosis assay using macrophages in the absence of complement, our result demonstrated that the ratio of intracellular bacteria was significantly increased by 16 μg/ml stevioside in MPMs (Fig. 7B), whereas such a promotion effect appeared at 64 μg/ml in RAW 264.7 cells (Fig. 7C), suggesting a discrepancy in the phagocytosis ability of different cell lines. Consistently, microscopic observation of Giemsa-stained RAW 264.7 cells exhibited visible and countable trapped bacteria in stevioside-treated cells compared to the vehicle group (Fig. 7D). Based on the above result, we speculated that stevioside may also improve opsonophagocytosis of S. pneumoniae by neutrophil, which could be attributed to increased complement activation and bacterial engulfment. Collectively, these results demonstrated that stevioside effectively impaired capsule-conferred immune evasion mechanisms during S. pneumoniae infection, as evidenced by the significant increase in adherence and phagocytosis.Fig. 7Stevioside restrained capsule-conferred resistance to host cell adherence and macrophage phagocytosis.A Adhesion assay of S. pneumoniae D39 to A549 cells in the presence of DMSO or indicated concentrations of stevioside. Overnight-cultured A549 epithelial cells were infected with D39 at an MOI of 100 for 2 h and then rinsed, lysed with 0.1% Triton X-100 and plated on THY agar plates after dilution. The number of colony-forming units (CFU) was determined after overnight culture. Data are presented as the percentage of the initial inoculum CFU. B Phagocytosis of S. pneumoniae D39 by mouse primary peritoneal macrophages (MPMs) in the presence of DMSO or indicated concentrations of stevioside. The cells were infected with an MOI of 50 for 1 h, followed by another 1-hour incubation in gentamycin containing (100 μg/ml) medium after PBS washing. Then, cells were washed, lysed, and diluted for determination of bacterial count by microbiological plating. C Phagocytosis of S. pneumoniae D39 by RAW 264.7 cells with the addition of DMSO or indicated concentrations of stevioside. The cells were infected and treated as described above. The phagocytosis percentage of each inoculum was defined as the ratio of phagocytized bacteria to the total bacterial count determined before adding gentamicin. D Giemsa-stained RAW 264.7 cells treated and infected as described above. The bright arrows indicate the intracellular bacterial. Scale bars, 100 µm. All data from three biological replicates were presented as mean ± SD and analyzed using One-way ANOVA and Tukey’s posttest. *P < 0.05, **P < 0.01, and ns, no significance compared with the DMSO control group.
To investigate the potential in vivo effect of stevioside on S. pneumoniae infection, we preliminarily performed a G. mellonella killing assay. Inoculation of 1 × 10^6^ D39 S. pneumoniae resulted in 90% mortality within 36 h. Promisingly, treatment with 50 mg/kg stevioside reduced the mortality from 90% to 50%, with a significant increase of 40% in survival rate (Fig. 8A). Moreover, a single treatment of stevioside without infection did not cause mortality (Fig. 8A), confirming that the compound was safe and non-toxic in vivo. At 6 h post infection, larvae were sacrificed and the bacteria load in haemocoel was determined. Consistently, the bacterial burden in the larvae haemocoel of stevioside-treated group was much lower compared to vehicle group, indicating stronger bacterial clearance by host defense under stevioside treatment (Fig. 8B). Melanization is defined as an indicative response of insect innate immune system associated with the pathogen’s ability to proliferate and evade immunity in Galleria, and the high level melanization is generally correlated with higher bacterial burden and poor survival^43^. Consistent with the reduced mortality and average bacterial burden, the degree of melanization was also significantly alleviated by stevioside, with an approximately 2-fold decrease (Fig. 8C). In conclusion, these results demonstrated that stevioside effectively protected G. mellonella from S. pneumoniae infection through suppressing capsule-conferred pathogenicity.Fig. 8Stevioside attenuated S. pneumoniae pathogenicity in the G. mellonella infection model.A Survival analysis of G. mellonella with different treatments. G. mellonella were challenged with 1 × 10^6^
S. pneumoniae D39 and then treated with 50 mg/kg stevioside in a 5% DMSO containing vehicle or an equal volume of vehicle (10 μl) immediately after infection. The larvae in negative group were treated with PBS and vehicle, and larvae in stevioside group were treated with PBS and stevioside as described above. Survival was recorded at 6-hour intervals. The data were analyzed using the log-rank (Mantel‒Cox) test (n = 10 larvae each group). B Bacterial load in hemocoel of larvae (presented as CFU/ml). Larvae were sacrificed at 6 h postinfection, and the hemocoel was serially diluted and plated on THY agar to determine bacterial burden (n = 8 larvae each group). C The melanization assay of the hemocoel from G. mellonella infected and treated as described above. The hemocoels was collected at 6 h postinfection and analyzed by measuring the absorbance at OD490nm (n = 6 larvae each group). The data presented as the means ± SD were analyzed using an unpaired two-tailed Student’s t-test. *P < 0.05 and **P < 0.01 compared with the vehicle control group.
Then, we further used a mouse model to evaluate the in vivo therapeutic effect of stevioside in lethal streptococcal pneumonia, and the dosage regimen was determined according to previous studies^44–46^. As expected, treatment with 50 mg/kg stevioside three times daily effectively protected mice from S. pneumoniae infection, with delayed death and a 44.44% increase in survival rate compared to the vehicle-treated group (Fig. 9A). Importantly, all the surviving mice remained alive and in good condition after discontinuing the medication. Accordingly, the average bacterial load in lung sections of mice treated with vehicle was approximately 10-fold higher than that of stevioside-treated mice (Fig. 9B). Meanwhile, as shown in the gross lesion changes (Fig. 9C), inoculation of sub-lethal S. pneumoniae caused visible dark red lesions with extravasated blood, and pathology assessment of lung tissues also showed obvious bronchopneumonia, characterized by severe edema with visible swelling, congestion and neutrophil infiltration (Fig. 9C). By contrast, both gross and histopathologic lesions were greatly improved by stevioside treatment. Consistent with the restricted airway inflammation observed in pathological section examination, the levels of inflammatory cytokines IL-6 and IL-1β were also markedly decreased by stevioside treatment (Fig. 9D, E). To make the therapeutic experiment closer to practical application, we further evaluated the therapeutic effect of stevioside at a dose of 150 mg/kg by subcutaneous injection once daily. Promisingly, such treatment also significantly increased mice survival (Fig. 9F), suggesting that the compound has a promising prospect in clinical practice. Similarly, the surviving mice also recovered well, indicating that stevioside-caused enhancement in pneumococcal epithelial adherence will not increase the risk of infection after stopping effective treatment. Of note, all experiments were conducted exclusively in age-matched female mice only, so future research on this candidate may need to be extended to males. Collectively, these data confirmed that stevioside also conferred systemic protection against lethal streptococcal pneumonia by suppressing capsule-associated pathogenicity.Fig. 9Stevioside significantly protected mice from lethal Streptococcus pneumoniae infection.A The survival rate of mice challenged with 5 × 10^8^ S. pneumoniae D39 with indicated treatments. Mice were subcutaneously injected with 50 mg/kg stevioside in the 5% DMSO containing vehicle or an equal volume of vehicle (50 μl) immediately after infection (n = 9 mice each group), and administration was maintained three times daily. B Bacterial burden in the mouse lungs infected with S. pneumoniae D39. Mice infected with 1 × 10^8^ S. pneumoniae D39 were treated as described above and sacrificed at 48 h postinfection. The lung tissues were removed and homogenized in PBS to determine the CFU by microbiological plating (n = 5 mice each group). C Gross observation and H&E staining of lung tissues from mice infected and treated as indicated. Scale bars, 100 µm and 50 µm. The levels of inflammatory cytokines IL-6 (D) and IL-1β (E) in the homogenates were determined by ELISA (n = 5 mice each group). F The survival rate of mice challenged by 5 × 10^8^ S. pneumoniae D39 with indicated treatments (n = 9 mice each group). Mice were subcutaneously injected with 150 mg/kg stevioside in the 5% DMSO containing vehicle or an equal volume of vehicle (50 μl) immediately after infection, and the administration was maintained once daily for 3 days. The survival rates were analyzed using the log-rank (Mantel‒Cox) test (n = 9 mice each group), and the data presented as the means ± SD were analyzed using an unpaired two-tailed Student’s t-test. *P < 0.05, **P < 0.01 compared with the vehicle control group.
As the most common respiratory bacterial pathogen, S. pneumoniae frequently causes hospital- and community-acquired pneumonia, accounting for approximately 25% of preventable deaths in children under 5 years of age globally, particularly when concurrent with pneumococcal septicemia^47^. Several studies revealed that S. pneumoniae is one of the most dominant co-pathogens of SARS-CoV-2, followed by Klebsiella pneumoniae and Haemophilus influenzae, and co-infection of these bacteria with SARS-CoV-2 might greatly increase the risk of complications and death in COVID-19 patients^48–50^. In addition, the opportunistic pathogen remains a leading cause of bacterial infection in HIV-infected individuals regardless of age, and the incidence of pneumococcal pneumonia and associated bacteremia is significantly increasing in countries with a high prevalence of HIV-1 infection^51^. Despite that polysaccharide-based pneumococcal vaccines have achieved significant advances and saved millions of people over the past few decades, S. pneumoniae still stands out as a predominant pathogen due to the widespread emergence and prevalence of multidrug-resistant non-vaccine clones^52^. Moreover, although up to 23 serotypes of the polysaccharide are included in PPV23, a commercially approved polysaccharide vaccine containing the most prevalent serotypes, a significant gap remains compared to the more than 100 identified serotypes of S. pneumoniae. Notably, due to the unavoidable gap in serotype coverage, both the frequency and antibiotic resistance of nonvaccine serotypes tend to increase. More importantly, vaccination also leads to a rapid rise in the frequency of preexisting drug-resistant variants of nonvaccine serotypes due to the elimination of competition from vaccine serotypes^52^. Unfortunately, the most frequent antibiotic treatment in S. pneumoniae infections include penicillin, trimethoprim/sulfamethoxazole and macrolides, all of which are widely used as common broad-spectrum antimicrobials to treat bacterial infections, are gradually declining^53^. Thus, novel alternative therapeutics are still urgently in need.
The fundamental role of capsule in the pathogenicity of S. pneumoniae renders it an attractive target for the development of anti-virulence drugs, which are defined as a novel therapy aiming to impede the infection process through disarming pathogen’s key virulence determinants that facilitate and sustain infections, rather than targeting central bacterial growth pathways^54^. Compared to vaccines, capsule-specific antibodies, and lytic enzymes from bacteriophages, chemical capsule inhibitors have the advantages of being broad-spectrum and low cost, yet there is no available candidate to date. Herein, we successfully identified stevioside as a potent capsule inhibitor that effectively reduced the production of capsular polysaccharide without effect on bacterial viability. Consistent with the visible decrease in capsule thickness, capsule-conferred pathogenicity was significantly impaired. Host antimicrobials provide the first line of defense against external invasion through direct antimicrobial activity and the regulation of innate antibacterial immune responses. For example, a recent study has revealed that, apart from antibacterial, the cathelicidin peptide LL-37 also functions as a potent Th17 potentiator to augment adaptive immune responses^55^. Interestingly, our results demonstrated that stevioside prominently sensitized S. pneumoniae to the killing of host antimicrobial peptide LL-37 and the synthetic antimicrobial peptide colistin. In addition, stevioside increased the deposition of complement components C3b and C5b-9 on the surface of S. pneumoniae by eliminating capsule, which could accelerate complement-mediated immune clearance during the early stage of infection and thereby help prevent invasive infection.
In addition to resisting the killing of host-derived antibacterial immune molecules, capsule also protects bacterial cells from multiple adverse stresses, such as extreme acidic conditions in the gastrointestinal tract, intracellular survival environments and reactive oxygen species (ROS)-mediated killing^56^. In agreement with the results mentioned above, we observed that stevioside remarkably attenuated the survival of S. pneumoniae under harsh acidic condition and H2O2-mediated killing, providing appealing evidence of decrease in capsule-conferred stress tolerance. Collectively, these data suggested that stevioside might contribute to the clearance of both extracellular free bacteria and intracellular trapped bacteria by inhibiting capsule production. As such, the combination of stevioside with appropriate antibiotics or the emerging host-directed therapy, which aims to enhance host bacterial-clearance-promoting response or interfere with the key pathways required for pathogenesis, might serve as desirable alternative or complementary strategies to combat resistant S. pneumoniae infections.
A growing body of evidence suggests that bacterial metabolism has a strong effect on pathogenicity and drug resistance. For example, a recent study reported that some central metabolic pathways, especially those related to purine metabolism, pyruvate metabolism, and the TCA cycle, significantly impact capsule biosynthesis and the pathogenicity of hypervirulent K. pneumoniae^57^. Wu and colleagues further illustrated that the increased activity of the glycine cleavage system and ATP production negatively regulated capsule-associated hypermucoviscosity phenotype of K. pneumoniae, thereby attenuating its high virulence^58^. By contrast, the repression of ongoing carbon catabolite and energy generation led to an obvious reduction in capsule production in S. pneumoniae and the latest progress also demonstrated that alteration in central metabolism related to energy loss enhanced the susceptibility of S. pneumoniae to antimicrobial killing and eradication by host immune response, and at the same time, reduced the expression of capsule and other important virulence determinants^27^. Given that metabolic pathways may represent a more conserved mechanism employed by S. pneumonia to regulate capsular polysaccharide synthesis, we further explored the potential mechanism of stevioside inhibiting capsule production using metabonomic-based techniques. In the present study, our results demonstrated that stevioside significantly altered several S. pneumoniae metabolic pathways related to pyruvate, ultimately leading to a pronounced decrease in intracellular pyruvate levels. Since pyruvate metabolism is vital for maintaining NAD + /NADH balance and stable energy generation, which positively influences capsule production and bacterial colonization, we propose that stevioside might also downregulate energy status due to the decline in pyruvate. Consistent with our speculation, although stevioside did not cause significant changes in the total NAD(H) pool, a stark increase in the NAD + /NADH ratio was observed compared to vehicle treatment, while intracellular ATP levels were dose-dependently reduced relative to the vehicle control. In addition to providing ATP required for the synthesis process of capsule polysaccharides, pyruvate might promote capsule biosynthesis as a critical carbon source through directly regulating capsule synthesis as one of the constituents making up the oligosaccharide repeat units^59,60^, or indirectly affecting the amount of UDP-sugar precursors indispensable for capsule synthesis via altering glycolysis flux^61,62^. Although the significant decrease in pyruvate explained how stevioside suppressed S. pneumonia capsule, the specific molecular mechanism needs further investigation in the future.
Overall, our study identified the natural compound stevioside as an effective S. pneumoniae capsule inhibitor that suppresses capsule production by altering pyruvate metabolism. As a result, the chemical inhibitor significantly impaired capsule-conferred resistance to oxidative stress and other noxious agents, as well as to AMPs-mediated killing. More importantly, capsule-mediated immune evasion mechanisms, including the blockade of complement deposition, epithelial adherence, and macrophage phagocytosis, were all significantly attenuated. In conclusion, the findings of our study pave the way for the development of capsule-targeted therapeutic strategies and the use of the promising alternative candidate, stevioside, as an intervention to address S. pneumoniae infections, particularly multidrug-resistant and non-vaccine serotype cases.
Stevioside purchased from Yuanye (Shanghai, China) was dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich) to make a stock solution of 20 mg/ml for in vitro experiments and in PBS supplemented with 5% DMSO for in vivo administration. FITC-dextran (2000 kDa, Sigma-Aldrich) was prepared as a 10 mg/ml stock solution in sterilized water. LL-37 purchased from Science Peptide (Shanghai, China) was dissolved in PBS. Tetraborate and 3-hydroxydiphenol used for the analysis of capsular polysaccharides based on uronic acid assay, were both purchased from Sigma-Aldrich. Amplex Red-based pyruvate assay kit, NAD + /NADH Assay Kit and ATP Assay Kit were all purchased from Beyotime (Shanghai, China). Mouse IL-1β and IL-6 ELISA kits (Biolegend) were used to determine cytokines. APC-conjugated mouse anti-C3b/iC3b antibody was from Biolegend, and mouse anti-C5b-9 primary antibody and Alexa Fluor 488-conjugated goat anti-mouse IgG (H + L) secondary antibody were from Abcam and Thermo Fisher, respectively.
The encapsulated serotype 2 S. pneumoniae D39 strain used in the study was stationarily cultured in Todd-Hewitt broth supplemented with 0.5% yeast extract (THY) at 37 °C. Human alveolar epithelial A549 cells and mouse RAW 264.7 macrophage-like cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 °C in a 5% CO2 incubator. Mouse primary peritoneal macrophages (MPMs) were induced using thioglycolate as previously described and cultured in Roswell Park Memorial Institute 1640 Medium (RPMI 1640) supplemented with 10% FBS^63^.
The potential effect of stevioside on D39 streptococci growth was determined by spectrophotometry as previously described in ref.^64^. Except for detecting OD values, the bacterial counts were also determined by CFU counting at each time point.
Cell-attached capsule level of D39 with or without stevioside treatment was evaluated using a uronic acids quantification assay as previously described in ref.^41^. In brief, overnight D39 culture was sub-cultured in 5 ml of freshly prepared THY medium containing indicated concentrations of stevioside or DMSO at a ratio of 50 to an OD600 of 0.5. Then, bacterial were collected by centrifugation at 12,000 rpm for 5 min, washed once with 150 mM Tris-HCl (pH 7.0), and resuspended in 500 μl of the washing buffer. Next, 200 μl of the bacterial suspensions was directly mixed with 1.2 ml of 0.0125 M tetraborate (in concentrated sulfuric acid) and boiled at 100°C for 5 min. After cooling on ice, 20 μl of 0.15% 3-hydroxydiphenol (in 0.5% NaOH) was added to the samples and vortexed to complete the reaction. Finally, the absorbance of each sample was measured on a Tecan Microplate Reader at OD520, and the CPS production was determined according to the standard curve of glucose. Additionally, a phenol-sulfuric acid method was also carried out to evaluate the production of CPS^65^.
Capsule thickness was measured by determining the exclusion zone of 2000 kDa FITC-dextran according to the method of Edmund et al.^66^. D39 strain was grown and sub-cultured as described above. Then, the bacterial were collected, washed with PBS, and resuspended in 500 μl of PBS. 10 μl bacterial suspensions were then mixed with 2 μl of FITC-dextran (10 mg/ml in water) and incubated for 5 min at room temperature. 1 μl of the samples was pipetted onto cleaned glass slides and fixed with coverslips for image capturing on an Olympus FV3000 confocal microscope.
To determine the capsule morphology of D39 streptococci, the overnight-grown D39 strain was sub-cultured in 5 ml of fresh THY medium at a ratio of 50 for 5 h, with the presence of DMSO vehicle or stevioside at indicated concentrations. Bacterial were collected by centrifuging at 5000 rpm for 5 min, rinsed twice with PBS, and then fixed in 4% glutaraldehyde overnight at 4 °C. Subsequently, the samples were embedded into LR white resin and cut into ultrathin sections with a diamond knife. The sections were then picked up using slot copper grids and counterstained with uranyl acetate and lead citrate for 10 min. After gently washing with water and air drying, the section samples were examined using an FEI Tecnai Spirit 120 kV TEM with a Tietz F4.15 CCD camera.
S. pneumoniae D39 strain stationarily cultured in THY medium with the presence of DMSO or 64 μg/ml stevioside were collected at mid-log phase by centrifugation, and the bacterial pallets were washed 3 times with PBS and weighed. Next, the samples were resuspended in 1 ml of pre-cooled 50% methanol and vortex for 60 s, followed by 5-min immersing in liquid nitrogen for rapid freezing. After thawing at room temperature, the samples were then homogenized using a high-throughput grinder at 55 Hz for 60 s. The supernatants were collected by centrifugation at 12,000 rpm for 15 min and concentrated to dryness under vacuum. Then, the dry samples were dissolved in 50% methanol (containing 5 ppm chlorophenylalanine) and filtered through a 0.22 μm filter membrane for evaluating instrument stability and data reliability, as well as LC-MS analysis.
LC-MS analyses were performed on a Thermo Fisher Scientific Vanquish UHPLC coupled with an Orbitrap Exploris 120 mass spectrometer (Thermo Fisher). For chromatographic separation, samples were injected onto an ACQUITY UPLC HSS T3 column (100 Å, 1.8 μm, 2.1 mm × 100 mm). The mobile phase A was 0.1% formic acid in water, and the mobile phase B was 0.1% formic acid in acetonitrile, flowing at a rate of 0.4 ml/min under 40 °C, with a 12 min 5% B, 0–1 min; 5 to 95% B, 1–7 min; 95% B, 7–8 min; 95 to 5% B, 8–8.1 min; 5% B, 8.1–12 min. DDA mass spectrometric data were collected in both positive and negative ion modes using a Thermo Orbitrap Exploris 120 mass spectrometer under the control of Xcalibur software (version 4.7, Thermo). HESI ionization was performed according to the following ion source spray voltage 3.5 kV/−3.0 kV, sheath gas 40 arb, auxiliary gas 15 arb, capillary temperature 325 °C and auxiliary gas temperature 300 °C.
The raw-format data were imported into the commercial software Compound Discoverer™ 3.3 (version 3.3.2.31, Thermo, Waltham, USA) to quantitate each metabolite based on peak area. The identification of metabolites was based on a self-built library, the PSNGM Database, mzCloud online library (https://www.mzcloud.org/), LIPID MAPS, HMDB, MoNA (https://mona.fiehnlab.ucdavis.edu/) and NIST_2020_MSMS spectral library. The MS1 mass tolerance was set to 15 ppm, and the MS2 Match Factor Threshold was set to 50. The principal component analysis (PCA), partial least squares discriminant analysis (PLS-DA), and orthogonal partial least squares discriminant analysis (OPLS-DA) were separately conducted using the R package Ropls for dimensionality reduction on sample data. P-values, OPLS-DA-derived variable importance in projection (VIP), and fold change (FC) were calculated to quantify the influence intensity and explanatory power of individual metabolite components on sample classification, facilitating the selection of discriminatory metabolites. Metabolites with p-values < 0.05 and VIP > 1 were considered statistically significant. Clustering analysis of differential metabolite abundances was carried out using the pheatmap package (version 1.0.12) in R, with heatmaps and trend analysis plots generated. Venn diagrams and UpSet plots for differentially expressed substances in two-group comparisons were created using VennDiagram (version 1.7.3) and UpSetR (version 1.4.0), respectively. Functional analysis of differential metabolites primarily involved in KEGG enrichment analysis using clusterProfiler (version 4.6.0), revealing significantly enriched metabolic pathways and calculating overall differential abundance scores to capture the average and overall trend changes of all differential metabolites within a given pathway, aiding in the identification of critical pathways. Metabolite network was conducted using a web-based MetaboAnalyst (version 6.0) tool, which calculated the biological pathways relevance and chemical structure similarity. The result was further visualized in CytoScape with version 2.7.2 (Seattle, USA).
Overnight stationarily cultured D39 strain were sub-cultured in fresh THY medium containing DMSO or indicated concentrations of stevioside, and were then collected at mid-log phase by centrifugation. The intracellular pyruvate, NAD + /NADH ratio and ATP levels were analyzed using Amplex Red-based pyruvate assay kit, NAD + /NADH Assay Kit and ATP Assay Kit, respectively.
SpxB-deficient D39 was constructed based on allelic exchange according to previous studies^67,68^, and primers used for gene knockout and verification are listed in Table 1. Briefly, ~0.5 kb of upstream and downstream flanking sequence of spxB locus was amplified using primers Upstream-sense/Upstream-anti-sense and Downstream-sense/Downstream-anti-sense, which were then spliced to erythromycin by overhang extension PCR using primers Erm-sense/ Erm-anti-sense. The fusion PCR product was subsequently transformed into D39 S. pneumoniae with the stimulation of CSP1. After overnight cultivation on the selective agar plate containing 1 μg/ml erythromycin, the positive transformants were verified by PCR using the primers spxB-sense/spxB-anti-sense.Table 1Sequence of primer pairs used for gene deletion and verificationGenePrimerSequence (5´-3´)UpstreamSensegtgggaattgctatgggtgcAnti-sensetattttatatttttgttcataatgataactctccttcaatttttttaaacDownstreamSensecgggaggaaataattcctctcgccgaaaatcaaatatgAnti-sensectcaatttctattttaaaaatagctaaggttaacgErmSensegaaggagagttatcattatgaacaaaaatataaaatattctcaaaacAnti-sensegattttcggcgagaggaattatttcctcccgttaaataatagspxBSensegctcgatgagtttttctaaatgactcaagggaaaattactgAnti-sensecatatttgattttcggcgagaggaattatttaattgcg
Total RNA of bacterial was isolated using TRIzol (TransGen Biotech, Beijing) according to the manufacturer’s instructions. The primer pairs used for qRT-PCR are listed in Table 2, and the qRT-PCR reaction ran on an Applied Bioscience 7500 thermocycler using FastStart Universal SYBR Green Master (Genestar, Shanghai). 16S rRNA served as the endogenous controls. RNA expression levels were normalized to the endogenous control gene for analyzing changes in gene transcription.Table 2Sequence of primer pairs used for RT‒qPCRGenePrimerSequence (5´-3´)cpsASensetgccttggtagggctactctAnti-sensegtgctgtcacactcgtcagtcpsCSenseacaagtcggggctgacaaatAnti-sensectggcttcctctggctgtttcpsDSenseacagacctatcacaagggctAnti-sensegaagcatcgcattttcgcgtcpsESensegaggttgttggggagttggtAnti-sensetgcttgttacgtgccaaactac16 s rRNASensegtagtccacgctgaaacgatgatgAnti-sensectgtcccgaaggaaaactctatct
Stress-response assays were performed as described previously in refs. ^17,69^. For the acid tolerance assay, exponentially growing S. pneumoniae were harvested and resuspended in low-pH THY medium (pH = 4.5, HCl) containing DMSO or indicated concentrations of stevioside for further growth. The growth curves of S. pneumoniae in low-pH conditions were determined spectrophotometrically at 1-hour intervals. For the oxidative stress assay, exponentially growing S. pneumoniae treated with DMSO or stevioside were collected and resuspended in sterilized PBS to reach an OD600 of 0.5 in 1 ml PBS. The suspensions were then incubated with 10 mM (final concentration) H2O2 in THY medium at 37 °C for 1 h, and the viable bacteria were determined by microbiological plating and normalized to the number of vehicle-treated group.
D39 strain was grown and sub-cultured as described above. To test the effect of stevioside on the sensitivity of D39 to LL-37-mediated killing, 1 ml of the bacterial cultures was harvested, washed twice and resuspended in PBS to reach OD600 0.1. 100 μl of the suspensions was then incubated with 10 μM LL-37 peptide in the presence or absence of indicated concentrations of stevioside at 37 °C. 10 μl of the aliquots from each sample was withdrawn at indicated time points, serially diluted (1:10) in PBS, and plated on THY agar plates to determine viable bacterial counts. Additionally, the antimicrobial activity of colistin was tested at the concentration of 128 and 256 μg/ml, with the addition of DMSO or 64 μg/ml stevioside. The antibacterial activity test was performed in triplicate.
D39 strains grown and sub-cultured as described above were harvested and washed with PBS. Then, the bacterial pellets were resuspended in PBS and incubated with 20% normal human serum (NHS) at 37 °C for 3 h. C3b/iC3b was stained with a mouse anti-C3b/C3bi-APC antibody for 20 min at room temperature, and C5b-9 was labeled with a mouse anti-C5b-9 antibody, followed by further incubation with Alexa Fluor 488-conjugated goat anti-mouse antibody for another 10 min. To exclude non-specific antibody binding, a serum-free control was set as negative control. After washing three times with PBS, 10 μl of each sample was dropped onto cover glasses for visualization on the Olympus FV3000 confocal microscope.
A549 cells were seeded in 24-well plates at a density of 2 × 10^5^ cells per well and cultured overnight. On the day of infection, cells were washed with PBS and then infected with D39 streptococci at an MOI of 100 in the presence or absence of stevioside for 2 h. Subsequently, the monolayers were rinsed three times with warm PBS and lysed with 500 μl of 0.1% Triton-X 100. The cell lysates were serially diluted 10 and plated on THY agar to enumerate the colony-forming units (CFU). The data are presented as a percentage of the initial inoculum CFU.
RAW 264.7 cells and MPMs were both plated in 24-well plates at a density of 8 × 10^5^ cells per well and cultured overnight. Cells were then infected with D39 streptococci at an MOI of 50 for 1 h, with each groups contained 6 replicate wells. After washing with PBS to remove unattached cells, the first half of the cells (n = 3) were directly lysed, serially diluted and plated on THY agar to enumerate the colony-forming units (CFUs); the other half were further incubated in fresh medium containing 100 μg/ml gentamicin to kill extracellular bacteria. After gentamicin killing for 1 h, the remaining cells were then washed and lysed as described above, and the cell lysates were diluted and plated for CFU counting. The phagocytosis percentage of each group was calculated as the percentage value relative to the total bacterial count determined before adding gentamicin. Additionally, RAW 264.7 cells were fixed with cold methanol after PBS washing and stained with Giemsa for microscopic observation.
G. mellonella killing assay was first carried out to evaluate the in vivo therapeutic effect of stevioside for lethal S. pneumonia infection as previously described in ref. ^70^. In brief, the D39 strains grown and sub-cultured as described above were harvested, washed and resuspended in PBS. 10 μl of the suspensions containing 1 × 10^6^ bacterial cells were injected into the foremost right-side proleg of the larvae using a microinjection pump, and subsequently, 10 μl of vehicle and stevioside was delivered into the left-side proleg at a dose of 50 mg/kg (n = 10 each group). The larvae in negative group were treated with PBS and vehicle, and larvae in stevioside group were treated with PBS and stevioside as described above. After treatment, larvae were grown in the dark at a 37 °C incubator and the survival status was recorded at 6 h intervals. In addition, the bacterial load in the hemocoel of larvae and melanization levels were determined at 6 h postinfection as previously described in ref. ^71^.
Female C57BL/6 mice aged 6-8 weeks were purchased from Changsheng Biotechnology (Shenyang, China) and humanely housed in individually ventilated cages (IVCs) under standard laboratory conditions with free access to food and water. For the survival assay, mice were intranasally challenged with 5 × 10^8^ pneumococci in PBS and treated with stevioside at a single dose of 50 mg/kg or an equal volume of vehicle (50 μl). The mice in control group were treated with PBS and vehicle in the same manner. Vehicle and stevioside were administered three times daily and maintained for 3 days, and the number of surviving mice was recorded until 7 days after inoculation. To better mimic the clinical application in which the subcutaneous injection would not be intensive to three times a day, we further evaluated the therapeutic effect of stevioside at a dose of 150 mg/kg once daily. Mice were infected and treated as described above except for changing the dosage to 150 mg/kg once daily. After the observation period ended, the surviving mice were euthanized following anesthetizing with isoflurane. To evaluate the histopathology and inflammation levels of mouse lungs, mice were inoculated with 1 × 10^8^ pneumococci, treated as described above, and euthanized following anesthetizing with isoflurane at 48 h after infection. The mouse lungs were fixed in 10% formalin for H&E staining and subsequent visualization of histopathological examination. In addition, lung tissues were homogenized in 1 ml of PBS for bacterial burden assay, and the cytokines in the supernatants were evaluated using ELISA according to the manufacturer’s instructions.
All statistical analysis were performed using GraphPad Prism 8.2.4 (USA).
The results from no less than three independent experiments are expressed as mean ± deviation (SD) in the study. The statistical significance between two independent groups was analyzed by unpaired two-tailed Student’s t-test, and comparisons of 3 or more groups were determined by one-way analysis of variance (ANOVA) and Bonferroni posttest unless otherwise indicated. The survival rates of mice and G. mellonella were analyzed using the log-rank (Mantel-Cox) test. *P < 0.05 and **P < 0.01.
Steviosid effectively combats S. pneumoniae infection as a potent capsule inhibitor rather than antibacterial activity. Mechanically, the natural compound suppressed capsular polysaccharides biosynthesis through interfering with pyruvate metabolism and subsequent disruption of bacterial NAD + /NADH redox balance and energy generation, thereby significantly attenuating the central immune evasion role of capsule in S. pneumoniae infection and facilitating effective host immune clearance.
All the animal experiments were approved and strictly conducted in compliance with the guideline of the Institutional Animal Care Committee of Jilin University (NO. SY202412070).
Description of Additional Supplementary Materials Supplementary data 1 Supplementary Data 2 reporting-summary