Authors: Flora Bai, Renjini Nambiar, Chirayu Padhiar, Wilson Aruni, Chinnadurai Veeramani, Mohammed A. Alsaif, Khalid S. Al-Numair
Categories: Original Article, amenorrhea, karyotyping, chromosomal abnormalities, clinical exome sequencing, chromosomal microarray
Source: Saudi Medical Journal
Authors: Flora Bai, Renjini Nambiar, Chirayu Padhiar, Wilson Aruni, Chinnadurai Veeramani, Mohammed A. Alsaif, Khalid S. Al-Numair
To identify the cytogenetic and molecular pattern abnormalities and early diagnose the cause of primary and secondary amenorrhea.
A total of 320 patients in the age group of 14-35 years with clinically confirmed amenorrhea were screened using conventional cytogenetic methods. Patients with a normal karyotype, hypoplastic uterus, and no hormonal imbalance were extensively investigated using molecular cytogenetic platforms such as chromosomal microarrays and clinical exome sequencing (CES).
Of the 266 patients with primary amenorrhea and 54 with secondary amenorrhea, 66.9% and 88.9%, independently, had a normal karyotype. The 20 patients with a normal karyotype, hypoplastic uterus, and no hormonal imbalance were further evaluated for microdeletions of <5 megabases using chromosomal microarray. In 20 cases, 5 samples with no microdeletions were investigated for 150 target genes using CES. A pathogenic variant at chromosome X BMP15, c.661T>C, p.W221R, HET-XL-VUS was observed in one patient (reclassification).
Cytogenetic evaluation of women with amenorrhea was performed in this study. One of the main etiological factors for primary amenorrhea is aberrant karyotypes. Identifying the underlying genetic cause may aid in devising effective treatment strategies. In addition, early diagnosis may enable treatment planning by the family before amenorrhea occurs.
The absence or abrupt timely menstrual cycle in female of reproductive age is known as amenorrhea. The major symptoms of amenorrhea are hirsutism, milk-like discharge from nipple, acne, alteration in sight, pelvic pain, and so on. Amenorrhea affects 2%–5% of women. Amenorrhea originates in 2 primary and secondary. Primary amenorrhea (PA) is when menstruation does not start at age 15 or 5 years following the onset of puberty (like growing breasts). It is typically brought on by acquired abnormalities and it may arise after birth or hereditary disorders. The sexual and anatomical growth problems, hypothalamus or pituitary illnesses, ovarian insufficiency, and other endocrine gland disorders encompass the mainstream of the fundamental sources of PA. Medication and physiology can also cause PA; however, they are more frequently linked to secondary amenorrhea (SA).^1^ It is diagnosed clinically when no menstrual history is found by the age of 15- or 3 years following menarche. When is missing period for 3 months or longer after having a regular period in the past, which is referring as SA. It is brought on by anomalies at several locations along the “menstrual pathway,” which includes the ovaries, pituitary, cervix, endometrium, vagina, and hypothalamus. The functional hypothalamic amenorrhea (FHA), primary ovarian insufficiency (POI), hyperprolactinemia, intrauterine adhesions, and polycystic ovary syndrome (PCOS) are common non-physiologic reasons. Pregnancy is ruled out during the initial evaluation, and typical causes are tested for using hormone levels, pelvic ultrasonography, and other focused tests.^2,3^
Based on World Health Organization estimates, fifteen percent of the global populations are sterile, and amenorrhea is the 6th chief prevalent cause of fertility problems in women. The array of potential factors underlying PA is extensive, encompassing hormonal disorders and genetic, psychological, environmental, and anatomical anomalies.^2^ Additional elements that may play a role include chromosomal abnormalities and disorders linked to a single gene. The frequency of chromosomal anomalies in PA varies considerably; with reported rates ranging from 15.9% to 63.3%. Primary amenorrhea presents a clinically diverse array of manifestations. If not addressed, it may lead to long-term health complications for the individual, such as non-fertile, sexual disorder, and a profound sense of refeminization. Furthermore, genetic analysis of the FSHR gene has revealed a significant correlation between the GG and AA genotypes of Ala307Thr (rs6165) with PA, while the AA genotype is predominant in SA emphasizing the importance of molecular screening for precise diagnosis and targeted management.^4^
Recent research highlights the activity of vitamin D receptor gene (VDR) variants in reproductive endocrinology by indicating that genetic polymorphisms, such as FokI, Tru91, and ApaI variants of the VDR gene, may enhance ovarian dysfunction, especially in the devlopment of polycystic ovarian syndrome (PCOS).^7,8^ Primary Ovarian Insufficiency is commonly linked to abnormal chromosomes, particularly X chromosome aberrations, which comprise 5%–10% of the instances. The genetic mutations that seen in gonadal dysgenesis is SRY, WT1, SOX9, DHH, NR5A1 and MAP3K1 which is necessary for the testicular development. The X chromosome variations include structural and numerical aberrations such as chromosomal imbalance, X-autosome translocations, eliminations, and inversions.^5,6^ Chromosomal and molecular analyses of these anomalies identified 2 crucial areas on the duplication of the Xq chromosomes in Xq13-q21 and Xq26-27. Although potential genes were found in the long arm Xq breakpoint areas, the actual genetic factors are yet to be elucidated, and these conjectural candidates must be verified by additional research.^6^
Conventional cytogenetics is the gold standard and most economical approach, although chromosomal abnormalities can still be effectively identified using modern genomic technologies such as chromosomal microarray and clinical exome sequencing (CES).
Prompt evaluation and treatment are crucial to prevent long-term social and health consequences. Effective and rational therapy relies on an accurate diagnosis, often achieved using clinical reasoning and basic tests, eliminating the need for intricate, advanced, and expensive treatments. The emergence of advanced molecular cytogenomic methods, such as chromosomal microarray analysis (CMA), has improved the diagnostic resolution. Chromosomal microarray analysis can identify imbalances in the kilobase range, clearly surpassing conventional karyotyping, which can only detect imbalances exceeding 7–10 million bases. Chromosomal microarray analysis directly identifies discrepancies in DNA copy number, often called microdeletions or microduplications, which are undetectable via conventional karyotype. Clinical exome sequencing is a cutting-edge molecular diagnostic tool that helps identify variants in the human genome. However, this technique enables the diagnosis of merely 20% of intersex conditions cases, resulting in the majority of gonadal dysgenesis cases remaining undetected at the genetic level.^7^ Conversely, the large quantities of data provided by next Generation Sequencing (NGS) facilitate the precise analysis of numerous genes and various mutation types with an exceptional efficiency. Indeed, NGS has been utilized to diagnose individuals afflicted by several illnesses involving many genes.^8^ Cytogenetic analyses is a must for better patient management when assessing women with amenorrhea. Hence, we were determined to identify the cytogenetic reasons of amenorrhea because there are many different explanations for PA and SA
The study was conducted in 320 prospective patient samples collected from various parts of India, with a clinical indication of suspected PA or SA. Among these 320 patients, 266 were identified positive for PA and 54 for SA, the age group ranged from 14 to 35 years. We used the inclusion and exclusion criteria to select the samples. Samples were collected from female patients, who have not attained menarche till the age of 14 and sample from patients who are not getting menses after menarche till the age of 45 based on the reproductive age. Exclusion Criteria: The sample wasn’t taken from prepubescent or postmenopausal women, pregnant or breastfeeding women, those who were taking medicine or drugs that affected their menstrual cycle, or those who had surgery on their genital tract in the past.
We collected samples from August 2021 to August 2022, a period spanning one year. Samples were collected from Indian-born patients who had clinical findings such as absent uterus and ovaries, blind vagina, streaked ovaries, infantile uterus, and hormonal imbalance, phenotype defects like short stature and with underdeveloped secondary sexual characters were collected and subjected for the cytogenetic studies. The study was approved by the committee from the Institutional Biosafety and Ethics Committee/IRB of Sathyabama Institute Science and Technology (Ref-136IRB-IBSEC/SIST), Tamil Nadu, India. Signed consent form along with the test requisition form was taken from each patient.
Peripheral blood sample were collected in heparinized vacutainer for the chromosomal study. Lymphocyte culture was performed according to Moorhead et al.^9^ As per the CAP and NABL guidelines duplicate cultures were setup for each sample. Clean culture vials containing 5 ml of RPMI-1640 media (Gibco) were filled with peripheral blood samples. Then phytohaemagglutinin (Gibco), penicillin–streptomycin antibiotic solution, and pooled human platelet lysate (5%-In house) were added. After processing and harvesting peripheral blood samples, we prepared metaphase slides and performed G banding. GenASIS software version 8.2 (GenASIS, USA) was used to perform the karyotyping after the staining samples had been placed into a computerized microscope (GenASIS, Germany). Every individual had at least 20 metaphases examined to eliminate chromosomal abnormalities (CA) as well as 30 cells to rule out mosaicism. Reports on karyotypic conditions have been developed as per the International System for Human Cytogenetic Nomenclature (ISCN) recommendations, ISCN 2020 and data was analyzed using standard descriptive statistics. The band resolution of Karyotype is 400-500 bphs. Individuals with structural or numerical changes in chromosomes have suggested genetic counseling along with additional therapy.
CMA was performed on 20 patients from both PA and SA by the Affymetrix 750K microarray which enables high-throughput SNP and CNV analysis. Genomic DNA was mined by using QIAgen Kit. The DNA was then diluted to a concentration of 5-7 ng/µL. Chromosomal microarray analysis was executed following the manufacturer’s protocol (CytoScanTm). 50 ng of the diluted DNA underwent digestion with Nsp I Buffer, followed by a PCR cycle. Ligation was carried out with the following DNA Ligase Bfr, Adaptor, Nsp I, DNA Ligase, combined with Nsp I digested sample. A subsequent PCR was performed. After further fragmentation, biotin labeling, and hybridization to probes, fluorescence detection was performed. Data extraction and normalization reveal genome-wide patterns for association studies. Analysis was performed using the software (Chromosome Analysis Suite) is designed by Affimetrix.
For NGS at 80-100X coverage, protein-coding regions related to inherited diseases were sequenced, with variant analysis focused on regions covered at 20X. GATK and Sentieon were used for alignment, deduplication, and variant calling, with deep variant on Google Cloud as a secondary pipeline. Non-synonymous and splice site variants were annotated using databases like OMIM and GNOMAD for clinical interpretation.
Data analyses. SPSS.24 version was used to analyze the data for the unpaired student t-test. The statistical significance was established at p<0.05. The mean ± SEM is shown by the error bars.
Both PA and SA have been investigated in 320 samples. There were 266 patients with PA, whose mean age was 17, range between 14-22 and 54 patients with SA, whose mean age was 23, range between 18-35. Among the 266 PA patients, 66.2% (n=176) had normal chromosomes, 11.3% (n=30) had developmental sexual disorder, 9% (n=24) had Turner syndrome, 6% (n=16) had some structurally abnormal autosomal and sex chromosomes, 2.6% (n=7) were with numerical sex chromosomal abnormality. In SA, out of 54 patients, 88.9% were with normal chromosomes, 5.6% were with Turner and numerical abnormality, 3.7% had sex chromosomes with structural abnormality and 1.9% (n=1) sex chromosome with numerical abnormality (Figure 1 & Table 1).

Amenorrhea patients with pure Turner syndrome have the clinical characteristics like short stature, heart defects, swollen hands and feet, narrow nails, Infertility, delayed puberty, Autoimmune disease, hypertension, webbed neck, and so on. The patients with 45,X karyotype was checked for the presence and absence of clinical features like webbing of neck, low occipital hairline, decreased length of neck, low-set pinna, shield chest, axillary hair, pubic hair, breast development, USG for hypoplastic and absence uterus and ovaries (Figure 2). Patients with karyotype XY females (Developmental sexual disorder) were checked for the External genetalia, all the 30 patients were with female genetalia, absence of axillary hair, crotch hair and mammogenesis. Ultrasonogram impression with hypoplastic right and left gonads present in 2 patients and absent in remaining 28 patients. Mullarian structures like hypoplastic uterus seen in 4 patients, remaining 26 patients identified with Absence of Uterus and Ovaries (Figure 3).


To rule out the possible causes of amenorrhea which is not discernible through conventional karyotyping, chromosomal microarray research was conducted. Among 320 amenorrhea patients, 20 individuals with a normal hormonal description, hypoplastic uterus, or streak ovaries and with a normal karyotype underwent chromosomal microarray to detect the copy number variation, structural variations and microdeletions. All the patients tested for chromosomal microarray was resulted as negative with no chromosomal gains or losses (Table 2). Patients with a normal hormonal profile, hypoplastic uterus, or streak ovaries with no abnormalities in traditional karyotype and chromosomal microarray are examined further to determine the cause of amenorrhea and to understand the molecular pathophysiology. In this study totally 5 patients were analyzed for CES, in which 4 patients exhibited no significant variants in the 150 targeted genes. One patient identified as pathogenic in Chromosome X in bone morphogenetic proteins (BMP)15 gene, Exon 2, missense variants c.661T>C, p.W221R, HET-XL-VUS (Reclassification), Theoretically deduced amino acids p.Trp221Arg221 was heterozygous (Figure 4).

This report deals with a 21-year-old woman with normal 46, XX karyotyping who was diagnosed with PA because of POI caused by an established genetic change in the BMP15 gene (ENSG00000130385 BMP15precursor), often referred to as GDF9B, ODG2, POF4 deficit at Chr X: 50,659,459-50,659,499 c.661T>C, p.W221R, HET-XL-VUS located at Exon 2 deficit at chromosome X:break point p11.1 included gene BMP15 and the sequence TCAAATCAGTTGGACCAGAGTGTCCCCCG GCCCTCCTGT (Figure 4).
The most crucial and fundamental tests for diagnosing amenorrhea are believed to be cytogenetic tests. The prevalence of sex CAs among individuals with amenorrhea is shown by several research studies. Published research indicates that one of the most prevalent causes of PA appears to be CAs. With CAs, the estimated percentage varies from 15.9% to 63.3%. Variations in the sample size and patient selection standards can account for this enormous variation in percentages.
Women with normal menstruation are considered potentially fertile individuals. A normal karyotype is very essential for normal development of a person. Abnormality in any chromosome indicates abnormal developments or disorders. Many studies reported the relationship between PA and abnormal karyotypes involving sex chromosomes. Genetic basis of PA revealed 27.5% abnormalities among the patients.^10,11^ Our study on the genetic basis of PA revealed 33.8% abnormalities among the patients (Figure 1).
There are several types of chromosomal abnormalities, and the percentage of abnormalities varies depending on the sample size and patient selection standards used. Chromosomal abnormalities such as true monosomy X or (45, X) (n=24), mosaicism (n=14) was observed in 12.7% of cases. The different pattern of Turner variant identified were mos45, X/46,XY, mos45,X/46,X,i(X), mos 45,X[/46,X,r(X), mos 45,X/46,X,der(X),t(?;r(X), mos 45,X/46,XX, and mos45,X/47,XXX. The vast amounts of data that next generation sequencing (NGS) provides make it possible to analyze many genes and many kinds of mutations with remarkable accuracy. In fact, people suffering from a variety of diseases involving several genes have been diagnosed using NGS.^8^ Compared to the published research articles the turner variants obtained in our study were significantly high with different cytogenetic pattern.^17^ Previous investigations have identified that PA is most frequently caused by Turner syndrome, which is the most prevalent cause; the results align with these findings.^11^ Chromosome abnormalities are present in 64.7% of PA patients with Turner syndrome in North Kerala, and Swyers syndrome is 11.8%, and the current study also the states, these 2 aneuploidyplays major role is cause of amenorrhea.^14^ The X chromosome’s gene makeup plays a crucial role in healthy female anatomy and reproduction, as demonstrated by the acquired results.
The isochromosome of X’s long arm [i(Xq)] is the primary structural abnormality that causes PA.^12^ Only 2 instances of the Xq isochromosome have been documented, one in pure form and one in the mosaic form.^13^ With structurally identical and gene-identical isologous arms, the Xq isochromosome resembles a metacentric chromosome. This results in the genes on Xp being partial monosomy and the genes on Xq being partial trisomy. The number of isochromosome or Turner variant presented in our study is also high 46,X,i(X)(q) 4.1% (n=11) and mosaic pattern (45,X/46,X, i(X)(q) is 2.3% (n=6), It has been discovered that females having the karyotype 46,X,i(Xq) exhibit streak gonads. In 46,X,i(Xq) females, there is a near-total loss of development of gonadal, short stature, and TS stigmata.^14^
Patients who have the 46-XY karyotype also have phenotypically female symptoms of Swyer syndrome, a rare condition linked to full gonadal dysgenesis.^15^ Females with 46,XY leads to PA. Mutations in the DNA linking region in the SRY gene, which is present on a Y-chromosome and is necessary for gonad development, are part of the pathophysiology of this disorder.^16^ Current study reveals the presence of developmental sexual disorder in 11.3% (n=30) of females with 46,XY features with female external genetalia, lack of axillary hair, hair on the pubic area, and growth in the breasts. Out of which 4 patients identified with mullarian structure like hypoplastic uterus. One patient with mosaic cytogenetic pattern 45,X/46,XY, (n=1). Swyer syndrome is second higher number in the patients studied for amenorrhea.^17^
In the present study, chromosomal microarray analysis was conducted in 20 patients exhibiting a normal karyotype, hypoplastic uterus, and normal hormonal profiles (Table 1). The American Congress of Obstetricians and Gynecologists (ACOG) endorsed the main test used for determining fetal structural anomalies is the chromosomal microarray. CMA functions by identifying discrepancies in DNA copy number. No abnormalities were identified in the investigated patients. CMA provides the advantage of identifying submicroscopic imbalances (<5 Mb) throughout the genome in a single assay, with its resolution solely constrained by the probes available on the chip. To elucidate the precise process of gonadal dysgenesis in XX that causes ovarian failure without any phenotypic abnormalities and to identify the possible genes implicated, we selected 5 individuals for examination via CES. One patient was identified with genetic variant.
One patient out of 5 had a single nucleotide polymorphism variation. This case of a young woman with idiopathic POI who has a small uterus on pelvic ultrasonography and a dysfunctional family shows how important it is to test for genes. This genes codes TGF-beta superfamily of proteins. A combination of the homologous protein, GDF9, and the designed preprotein undergoes proteolytic processing to produce disulfide-linked homodimer subunits or, in addition, a heterodimer. This protein stimulates follicular cells, which contributes to follicular growth and oocyte maturation. POF is linked to ovarian dysgenesis, which is caused by abnormalities in this gene. By suppressing the effects of FSH, BMP15 promotes follicular development and delays premature luteinization. POI can result from allelic insufficiency or predominant adverse effects resulting from heterozygous mutations within BMP15, which affect protein processing and drastically limit the synthesis and biological impact produced by the mature protein.^18^
Primary ovarian insufficiency is a diverse condition that, in its grave manifestations, arises from ovarian dysgenesis. Ovarian dysgenesis constitutes around fifty percent of PA cases.^19^ The majority of instances are linked to significant abnormalities of the X chromosome. Genetic investigations have found many loci at Xq and Xp11.2-p.22.1 that are pertinent to maturation of ovaries.^20^
Genes critical for proper development of ovaries are situated on X chromosome arms.^21^ The normal genetic method of sex chromosome translation, including the final identification in phenotypic sex, is disrupted by an abnormality in the number or arrangement of the X chromosom.^22^ The aberrant phenotypes originate from gene disruption, positional effects, or deletions at one of the breakpoints, leading to haploinsufficiency of essential X-linked genes. Deletions and translocations of the X chromosome have facilitated the identification of loci (POF1-POF2 and POF3) associated with illness etiology.^23^ In nonsyndromic primary ovarian insufficiency, only exceedingly rare mutations in autosomal genes, including FSHR, BMP15, NR5A1, and FIGLA, have been documented, indicating the existence of unidentified additional factors.^24-27^
The main focus of this study is the relationship between unsuccessful ovarian development and the germline condition associated with the BMP15 protein. It is a significant X-linked potential gene linked to ovarian dysfunction as it is found at Xp11.2 in the POF critical area.^28^ BMP15 appears at low levels only in the gonads, GDF9 mRNA is extremely prevalent in the egg cells of the human ovary’s first follicles.29 Oocytes from a variety of mammal species produce BMP15.30 The TGF-beta superfamily has a 6-pattern of conserved cysteines, but it doesn’t have the extra cysteine that helps the BMP family oligomerize. BMP15 promotes granulosa cell proliferation, suppresses the expression of FSHR, and also enhances the expression of KIT ligand.^31^
Bone morphogenetic proteins factors are part of the superfamily of TGF-b transforming growth factors, which participate in numerous biological functions, such as reproduction.^32^ Type I receptors are transphosphorylated by BMP ligands once they reach the outside of the cell and connect with type II receptors on the cell surface.^33^ BMP15 and GDF9 ligands, essential components of ovarian biological process, are associated with activation of BMPR2 in human and mice.^34-36^ Egg cells in the ovaries produce a significant amount of BMP15:GDF9, which has more physiological uses than homodimers (BMP15:BMP15 or GDF9:GDF9).Research indicates that BMP15:GDF9 function through the group of receptor like BMPR2-ALK4/5/7-ALK complex situated in granulose or follicular cells.^37^ Given that BMP15 sequence variants are associated with the etiology of POF, we hypothesize that mutations in the BMPR2 coding region may also contribute to the condition.^38^
The heterozygous mutation identified in our case strongly indicated a harmful consequence. Genetic abnormalities in GDF9 are seen more probable to induce primary ovarian insufficiency (POI), particularly as GDF9 seems to be involved in a process that regulates expression of FSHB gene.^39^ Furthermore, FSH, BMP15, and GDF9 appear to control follicular cell AMH expression.^40^ Belli and Shimasaki^39^ indicate that the mutation rate of GDF9 in POI is markedly elevated compared to female controls. Additionally, pathogenic variants of GDF9 with POI that have been seen in humans include both heterozygous and homozygous alterations. In this setting, defective GDF9 in a patient can account for oscillations in FSH levels and diminish the level of AMH.
In conclusion, chromosomal examination of women with amenorrhea agreed with the findings of the current study. Chromosomal abnormalities, including aberrant karyotypes, are among the main etiological factors for PA. In addition, it provides compelling evidence linking naturally existing variations to ovarian tissue failure. Further population research is necessary to establish the BMP15 family as an epidemiological indicator for the function ovarian failure. Hence, targeted NGS sequencing holds promise for enhancing the identification rate of disorders of sexual development. This would help medical professionals interpret differential diagnoses and offer genetic counseling, including timely therapy, for those affected. Early diagnosis of chromosomal abnormalities and genetic therapies are approaches that treat the genetic disorders before the reproductive age of the patients by providing new DNA to certain cells or correcting the DNA. This study demonstrates the intricacy of POF as several chromosomal anomalies result in the same symptoms. Furthermore, the findings from this research confirm the significance of the X chromosome in its etiology. Future studies should be focusing on more elaborated molecular mechanisms with more populations.