Authors: Guocheng Qian, Jiaying Zhang, Leyao Shi, Dongmei Li, Biao Yang, Biao Chen, Dongmei Shi
Categories: Case Series, ., chronic mucocutaneous candidiasis, diagnosis, treatment
Source: Infection and Drug Resistance
Doi: 10.2147/IDR.S456121
Chronic Mucocutaneous Candidiasis (CMC) is a rare immunodeficiency disease characterized by chronic or recurrent superficial Candida infections on the skin, nail, and mucous membranes. Here, we present four Chinese patients with CMC who manifested oral mucosal leukoplakia and nail thickening during early childhood, all displaying fissured tongue lines. The causative pathogens isolated from their oral mucosa and nails were identified as C. albicans and C. parapsilosis through morphology and molecular sequencing. Notably, among the four patients, one presented with vitiligo, while another had hypothyroidism. We have also conducted a review of reported cases of CMC in China and worldwide over the last five years, highlighting potential approaches for diagnosis and treatment. The current molecular evidence in the literature suggests potential for the development of early diagnosis methods, such as screening genetic variables on STAT1 and STAT3. Additionally, potential treatment avenues, including gene-targeted analogues and GM-CSF analogues, could be explored in conjunction with traditional antifungal therapy.
Keywords: chronic mucocutaneous candidiasis, Candida spp., diagnosis, treatment
Chronic mucocutaneous candidiasis (CMC) is a rare primary immunodeficiency disease characterized by chronic or recurrent superficial Candida infections on the skin, nails, and mucosal membranes.^1^ The development of CMC is believed to be associated with genetic or acquired T-cell immunodeficiency.^2^ The mucosal antifungal T-cell immune response plays a crucial role in clearing Candida spp., primarily through the release of IL-17.^3^ An impaired Th17 cell response, resulting in decreased IL-17 secretion, is a common trigger for CMC. A genetic factor commonly associated with an impaired IL-17 immune response is the presence of gain-of-function (GOF) mutations in signal transducer and activator of transcription 1 (STAT1).^2^
CMC typically manifests early in life, with antifungal agents being the first-line treatment. However, a significant portion of patients exhibit poor response to antifungal treatment, and prolonged use may contribute to the emergence of drug-resistant strains.^4^ Given its rarity and complexity, CMC necessitates careful attention.
In this report, we present four patients diagnosed with CMC. Among them, a 6-year-old child and a 40-year-old male had a family history of the disease. We conducted screening for common reported mutations, including CARD9, STAT1, IL-17R, STAT3, IL-12R, and IL-6R, using Sanger sequencing technology, yet found no identical mutation across all four patients. Furthermore, through a comprehensive literature review of CMC cases globally over the past five years, coupled with our findings from these four patients, we analyzed the association between mutation sites and clinical manifestations and complications.
The current molecular evidence in the literature suggests potential for the development of early diagnosis methods, such as screening genetic variables on STAT1 and STAT3, as well as potential treatment avenues, including gene-targeted analogues and GM-CSF analogues, in conjunction with traditional anti-fungal therapy.
A 6-year-old child presented with a 5-year history of oral mucosal leukoplakia and a 2-year history of thickened fingernails. The child developed a white pseudomembrane in the oral mucosa 8 months after birth. The child was initially diagnosed with “thrush” at a local hospital. Although “thrush” recurred intermittently, it was effectively relieved following antifungal treatment. Three months ago, when the patient turned 6 years old, the father noticed that the middle nail thickening of the child’s right hand, prompting them to seek medical attention. Physical examination revealed white patches and slight striae-like changes in the child’s oral mucosa, while the right index finger appeared brittle and discolored. All blood test results were normal with no increases in immunoglobulin and neutrophil levels. Examination of oral mucosa samples under a light microscope, revealed the presence of hyphae (Figure 1). A portion of the sample was also inoculated onto Sabouraud Dextrose Agar (SDA) and cultured at 37°C for 3 days. The isolated colonies were then identified as C. albicans through fungus-specific primer (ITS1: TCCGTAGGTGAACCTGCGG; ITS4: TCCTCCGCTTATTGATATGC) amplification and sequencing matching in NCBI database. Gene sequencing analysis of the patient’s blood sample did not reveal any exon mutations reported in genes such as CARD9, STAT1, IL-17R, STAT3, IL-12R, and IL-6R. Based on the clinical and fungal identification, the patient was then diagnosed with CMC. The patient’s father (patient No. 2) had a similar medical history.
Figure 1 Patient No.1 (A) Image of oral mucosal of the patient No.1 (B) Image of right-hand fingers of the patient No.1 (C) Microscopic findings of oral mucosa from the patient No.1.
During the consultation, the father of patient No. 1 drew our attention by discussing his son’s medical history. The father complained of a 30-year history of white spots and 25-year history of nail thickening. Approximately 29 years ago, white spots initially appeared on his oral mucosa when he was one year old. The patient was diagnosed with “thrush”, and received oral treatment with sodium bicarbonate solution, itraconazole and fluconazole. The patient responded well to antifungal treatment and the lesion completely disappeared. Approximately 25 years ago, when the patient was 5–6 years old, the nails on both hands became thickened, discolored, and brittle. Antifungal treatment provided significant relief and improved the condition of the nail. However, nail issues recurred when treatment was discontinued. Three years ago, despite receiving oral and topical antifungal agents, the nail lesions only partially resolved. Physical examination revealed white patches and deep cracks in the oral mucosa, as well as brittle fingernails (Figure 2). Whole blood test results were normal, with no elevated white blood cell or immunoglobulin levels. Nail crip and the oral mucosa were also inoculated on SDA and blood agar. A yeast colony was isolated after two days and identified as C. albicans through morphology and molecular sequencing. The isolated strain showed sensitivities to miconazole (MIC=0.25) and anafraniline (MIC=0.25), but resistance to itraconazole (MIC>8), fluconazole (MIC>64), terbinafine (MIC>8), ketoconazole (MIC>8), amphotericin B (MIC>4), and voriconazole (MIC>4). Additionally, gene sequencing analysis of the patient’s blood mononuclear cells did not reveal any common exon mutations on CARD9, STAT1, IL-17R, STAT3, IL-12R, and IL-6R.
Figure 2 Patient No.2 (A) Image of oral mucosal of the father of the patient No.1 (B) Image of fingers of the father of the patient No.1.
A 6-year-old child reported a history of thrush spanning five years and nail thickening over the past three years. Additionally, the patient had a history of hypothyroidism for two years and was of short stature. The child initially developed oral mucosal leukoplakia six months after birth, which improved with effective antifungal treatment. However, the child returned for follow-up due to the recurrence of oral mucosal leukoplakia. Physical examination revealed white spots and fissure lines on the oral mucosa, along with thickening of the tongue. Mild changes suggestive of onychomycosis were observed in the patient’s nails. The nail grooves gradually deepened, there was discoloration around the nails, and the nails became brittle (Figure 3). Despite these symptoms, the child exhibited normal cognitive ability. Blood tests showed normal levels of white blood cells and immunoglobulins, including IgA, IgG, IgM, and IgE. However, serum hormone assay revealed lower concentration of FT4 (Free Thyroid Hormone 4) and at 22.39 pmol/L (normal 12.1–21 pmol/L), along with higher levels of TSH (Thyroid Stimulating Hormone) at 6.11pmol/L (normal 0.2–5 pmol/L). These data indicate reduced FT4 levels accompanied by increased TSH levels, an indicative of hypothyroidism. Direct microbiological examination of the nails and oral mucosa revealed the presence of hyphae. Samples from the oral mucosa and nails were inoculated onto SDA and blood agar plates at 37°C or 3 days, resulting in the growth of yeast colonies. The colony was identified as C. parapsilosis by morphology and molecular sequencing. The patient was diagnosed with CMC and hypothyroidism. The patient was not consanguineous and there were no similar cases within the family. The same panel of gene sequencing as patient No.1 did not reveal any exon mutations in this patient.
Figure 3 Patient No.3 (A) Image of oral mucosal of the child (B) Image of fingers of the child (C) Results of incubation on SDA at 37°C from the oral mucosal of the patient.
A 40-year-old male presented with thickened fingernail caps, recurrent generalized plate flaking for over 10 years, and a 20-year history of vitiligo. The patient had been experiencing recurrent oral mucosal leukoplakia since early childhood. While symptoms could be improved with effective antifungal treatment, the recurrence of oral mucosal leukoplakia prompted the patient to seek medical attention. Upon physical examination, a white membrane covering almost the entire tongue was observed, accompanied by a deep crack in the middle. The nail plates appeared thickened, blackened, and brittle (Figure 4). The patient also manifested as flaky white patches on the face, as well as upper limb version friend-flaking symptoms (Figure 5). Additionally, scaly red patches with clear border appeared on the arms and back, accompanied by simultaneous pimples and blisters on the edges (Figure 6). Scales were sampled from the hands, oral cavity and back, superlatively. Light microscopy detection revealed the presence of a large number of fungal hyphae from all the lesions. Trichophyton rubrum was isolated and identified from lesions on the upper limbs and back, and C. albicans isolated from the oral mucosa and nails by morphology and molecular sequencing. There is no known family history of similar disease or condition. Gene sequencing in the blood mononuclear cells did not reveal any exon mutations in the genes.
Figure 4 Patient No.4 (A) Image of oral mucosal of the patient (B) Image of fingers of the patient (C) Results of incubation on SDA at 37°C from the oral mucosal of the patient.
Figure 5 Patient No.4 (A) Image of white spot on the face of the patient (B) Image of right upper limb of the patient (C) Image of left upper limb of the patient.
Figure 6 Patient No.4 (A) Image of Trichophyton rubrum infection on the right-hand (B) Image of Trichophyton rubrum infection on the back.
Chronic mucocutaneous candidiasis (CMC) typically manifests during childhood, with onset commonly observed around one year of age. The condition is often characterized by infections of the oral mucosa and nails. CMC is often sporadic and may result from chromosomal gene mutations or secondary to other T-cell immunodeficiency diseases. Family history of CMC is relatively rare. Comorbidities are frequently observed in CMC patients, and prolonged exposure to Candida spp. in the mucosa can elevate the risk of developing cancer. Hence, early diagnostic screening and effective treatment are crucial for managing CMC patients.
Oral mucosal leukoplakia is an early symptom of CMC and is typically observed a few months after birth. Patients with CMC often exhibit a thickened tongue with visible lines, which become more prominent with age. We speculated that Candida spp. infection in the epithelium of the tongue stimulates its proliferation, resulting in inflammation and thickening of the tongue. While the grooved tongue, often painless, can be attributed to genetic factors and is commonly observed in conditions such as psoriasis and other infectious diseases, refractory tongue fissures have also been documented in cases of CMC, which could serve as a sign of early CMC. Nail infections caused by Candida spp. are common manifestations of CMC as well, particularly in patients aged 5–6 years. As the disease progresses, the infection of the oral mucosa and nails tends to deepen. Intraesophageal candidiasis is commonly associated with esophageal strictures and esophageal cancer.^5^ In these cases, oral culture and fecal cultures could be used to effectively screen for esophageal Candida infections instead.
CMC is usually complicated by various autoimmune diseases including thyroid disorders, hematopoietic system disorders, and vitiligo (Table 1 and Figure 7). These diseases are often characterized by the production of abnormal immunoglobulin (specifically anti-melanocytes and haemophilic antibodies). It has been observed that some CMC patients have higher serum IgG levels when compared to health individuals without CMC condition.^6^ Interestingly, research has demonstrated that elevated IgG levels in patients with CMC are associated with an increased likelihood of developing lung disease.^7^ Therefore, screening for those autoantibodies can aid in the early diagnosis of these comorbidities.
Figure 7 (A) Mutation site and common complications in CMC patients worldwide in the last 5 years from the database (B) Mutation site and common complications in CMC patients in China in the last 5 years.
CMC condition has been associated with multiple gene mutations in STAT1, IL-17RA, and AIRE. Additionally, a small number of CMC patients with the mutation in STAT1 or TRAF3IP2 have been found to have esophagus or vaginal membrane involvement and many other diseases. For instance, STAT1 mutations are found in autoimmune diseases and deep-seated infections.^4^ STAT1 mutation in hypothyroidism and type 2 diabetes are complicated with aplastic anemia, systemic sclerosis, and bronchiectasis.^2^^,^^14^ Mutations in IL-17R and the mannose receptor responsible for mucosal fungal clearance can result in mucosal candidiasis and bacterial skin infections.^28^^,^^34^ Mutations in TRAF3IP2, an articulatory protein involved in signaling downstream of the IL-17 receptor, are associated with hypergammaglobulinemia and atopic dermatitis, which are related to the antibody levels in the body. In addition to susceptibility to Candida spp., AIRE mutations are involved in eye diseases.^35^ Therefore, the effective screening of these commonly mutated genes can help predict the occurrence and complications of CMC. In the past, identification of new mutation sites in patients was challenging due to the lack of high-throughput sequencing technology. However, with advancements in sequencing technology, more mutation sites in patients with CMC have been identified in recent years. The information regarding clinical manifestations and gene mutations in reported patients with CMC is detailed in Table 1. We observed a gradual increase in cases favoring the functional acquisition of STAT1 due to gene mutations.^36^
There are significant challenges in treating CMC due to its genetic predisposition and T-cell dysfunction, leading to limited effective therapeutic options. Currently, clinical treatments mainly include the use of antifungal drugs such as amphotericin B, fluconazole, itraconazole, voriconazole, and topical nystatin. Relief from skin lesions is typically observed within two weeks of antifungal treatment. However, the prolonged use of antifungal agents may lead to resistance and reduced efficacy. Although Candida speciation is not commonly conducted in CMC patients, it can provide valuable insights into antifungal therapy. We encountered two cases of CMC caused by C. parapsilosis, that presented with the same symptoms as C. albicans infection. One case was associated with hypothyroidism, whereas the other had additional infections. An epidemiological study conducted in dermatology clinics revealed that C. albicans infections were more severe and required longer treatment than non-C. albicans infections (N-CA) infections.^37^ However, a specific link between Candida species and CMC has not been reported. Immunoglobulins, such as IgG, can enhance the phagocytosis of microorganisms by binding to their surfaces, thereby aiding in the clearance of fungal infections.^38^ Clinical trials investigating the use of intravenous and oral human polyvalent IgG in patients with CMC have been conducted. Human polyvalent IgG administered as a mouthwash has been reported as an adjuvant treatment for CMC, particularly for oral candidiasis.^39^
JAK inhibitors targeting the STAT pathway have shown promise for the treatment of infectious skin diseases.^40^ Clinical trials have demonstrated a significant improvement in symptoms in patients with CMC with the use of JAK inhibitors for a short course, although side effects have been reported.^41^ Therefore, JAK inhibitors or other gene-targeted drugs could be potential therapeutic options in the future treatment of CMC.^42^ Single-cell sequencing of STAT-GOF patients with CMC revealed upregulation of tumor necrosis factor alpha-induced protein 3 (TNFAIP3).^43^ TNFAIP3 has been reported be linked to suppressing the innate immune response and is involved in autoimmune diseases, suggesting it as a potential therapeutic target for CMC.
In addition to gene-targeted approaches, the use of drugs that maintain or promote T cell recovery represents another potential option for CMC treatment. For example, stimulation with granulocyte-colony stimulating factor (GM-CSF) or granulocyte monocyte-colony stimulating factor (G-CSF) may enhance Th17 cell differentiation and aid in recovery from fungal infection.^44^ Clinical studies have shown that a combination of G-CSF and antifungal agents is highly effective in treating invasive fungal infections associated with CARD9-induced immunodeficiency.^45^ Recently, biologics targeting GM-CSF, such as otilimab, gimsilumab, and lenzilumab, have undergone clinical trials worldwide for various skin conditions.^46^ Additionally, hematopoietic stem cell transplantation may be considered as a treatment option.^47^
This work was supported by grants from the National Nature Science Foundation of China (NM 82272358).
This study was approved by the Institutional Research and Ethics Committee of Jining No. 1 People’s Hospital to publish the case details. All patients or the parents of the patient gave consent to publish provided written informed consent for publication of this case report and any accompanying images. The study was carried out in accordance with the principles of the Declaration of Helsinki. The first author vouches for the completeness and accuracy of the data and for the adherence of the study to the protocol.
All authors made a significant contribution to the work reported, whether that is in the conception, study design, execution, acquisition of data, analysis and interpretation, or in all these areas; took part in drafting, revising or critically reviewing the article; gave final approval of the version to be published; have agreed on the journal to which the article has been submitted; and agree to be accountable for all aspects of the work.
The authors declare no conflicts of interest regarding the publication of this paper.